KROONINEN BORRELIOOSI
Valvojat:Jatta1001, Borrelioosiyhdistys, Waltari, Bb
KROONINEN BORRELIOOSI
Soile Juvonen TtT
Kroonista borrelioosia ei juuri tunneta, vaikka borrelioosiin sairastuneista yhä useammat kärsivät kroonisista oireista tartunnan jälkeen vuosien jopa koko loppuelämän ajan. Borrelioosin diagnostiikka laboratoriodiagnostiikan pohjalta on kyseenalaista, sillä tämänhetkiset (2010) borreliatestit eivät useiden tutkimusten mukaan ole riittävän luotettavia. Vasta-ainetesteihin luotetaan kaikesta huolimatta suuresti ja hoito perustuu valitettavan usein yksinomaan testituloksiin. Useiden näkemysten mukaan kuitenkin sellaiset henkilöt, joiden vasta-ainetestit ovat negatiiviset, ovat monesti sairaampia kuin ne, joiden vasta-aineiden määrä on korkealla. Asiasta on näyttöä joidenkin muiden sairauksien kohdalla. Esimerkiksi sellaiset lepraa sairastavat henkilöt, joiden immuunijärjestelmä toimii ja kykenee muodostamaan vasta-aineita, sairastavat taudin lievempänä kuin ne, joilla vasta-aineita ei esiinny.
Negatiivinen vasta-ainetulos saattaa johtua useista syistä. Mm. Tri Whitaker ei ole juurikaan tavannut borreliabakteerin spirokeettamuotoa verestä, Yleensä hän löytää bakteerin L-muotoisena (bakteerin nuoruusmuoto, joita tavataan esim. silloin kun ne tulevat esiin kystamuodon sisältä. Mm. kystamuodosta johtuen elimistö ei tunnista bakteeria eikä muodosta vasta-aineita sitä kohtaan eivätkä vasta-ainetestit välttämättä ole positiiviset. Tri L. Mattmanin mukaan borreliabakteerit muuntuvat erittäin tehokkaasti eri muotoihin ja sen vuoksi borrelioosia tutkittaessa, ei tule etsiä bakteerin klassista spirokeettamuotoa, vaan pleomorfisia muotoja. Hän on löytänyt ruumiinavauksen yhteydessä useiden MS-tautia sairastavien aivoista borreliabakteerin eri muotoja. Hänen mukaansa kaikki Parkinsonin tautia sairastavat, jotka olivat saaneet borrelioosin hoitoon tarkoitetun antibioottihoidon, tulivat parempaan kuntoon. (Report From the 30th Anniversary of LymeDisease With No Compassion Observed May 7, 2005).
Luotettavien testien puuttuessa borrelioosia sairastavat henkilöt eivät aina välttämättä saa diagnoosiksi Borrelioosia. Borrelia-bakteeria, sen käyttäytymistä eikä bakteerin kykyä aiheuttaa mitä moninaisimpia oireita, ei tunneta kovin hyvin. Borrelioosi saattaa aiheuttaa oireita, jotka ovat tyypillisiä useille eri taudeille, kuten reuma, lupus, krooninen fatiikki, fibromyalgia, MS-, Parkinsonin-, Alzheimerin- tai ALS-tauti.
Mikäli testitulokset ovat negatiiviset, annetaan diagnoosiksi useimmiten jokin muu kuin Borrelioosi. Tästä johtuen kroonista borrelioosia sairastavat saavat useimmitenlukuisia diagnooseja riippuen pitkälti siitä, minkä erikoisalan lääkärillä ovat käyneet. Lopulta, kun moninaisille oireille ei löydy selitystä laboratoriotesteistä, henkilölle ilmoitetaan hänen oireidensa olevan todennäköisimmin psyykkisiä. Tämä siitäkin huolimatta, että lukuisissa tutkimuksissa borreliatestien epäluotettavuus on todettu. Tutkimuksissa on myös toistuvasti todettu borrelia-bakteerin kyky selviytyä elimistössä antibioottihoidoista ja immuunipuolustuksesta huolimatta.
Neuropsykiatri B. Raxlenin mukaan somatisaatiohäiriö diagnoosin saaneilla potilailla, esiintyi usein positiivisia vasta-ainetuloksia. Hänen mukaansa lääkärit diagnosoivat taudin helposti psykosomaattiseksi, silloin kun eivät löydä helposti, selkeää fyysistä selitystä potilaan moninaisille oireille. Tri Horowitzin mukaan krooninen borrelioosi saattaa oireilla missä päin elimistöä tahansa; iho, keskushermosto, sydän/verisuonet, silmät, luusto/lihaksisto jne. Kroonisen borrelioosin hoito kestää hänen mukaansa yleensä vähintään vuoden tai pidempään. Yleissääntönä on, että hoitoa tulee jatkaa vähintään 2 kk sen jälkeen, kun oireet ovat hävinneet. Hoidon pituus johtuu siitä, että borreliabakteeri kasvaa hitaasti ja se kykenee piiloutumaan solujen sisään jne. Tri Horowitz painottaa, että vain hyvin harvoilla kroonista borrelioosia sairastavista löydetään positiivisia vasta-ainetuloksia (ELISA, Western Blot).
(Report From the 30th Anniversary of LymeDisease With No Compassion Observed May 7, 2005).
Tri Brian Fallon on New Yorkissa Columbian yliopiston johtava borrelioositutkija. Hän tutki 37 kroonista borrelioosia sairastavaa henkilöä mm. aivojen magneettikuvauksen avulla. Hän selvitti myös antibioottihoidon tehoa tautiin.
Tutkimuksessa selvisi, että kroonista borrelioosia sairastavilla oli samantyyppisiä kipuja kuin potilailla, jotka on leikattu, MS-taudille tyypillistä fatiikkia ja sydäntaudeista kärsiville tyypillistä toiminnallista heikkoutta.Aivojen kuvantamistutkimuksissa selvisi että sairastuneilla oli laaja-alaisia puutteita aivojen verenvirtauksessa ja aivojen aineenvaihdunnassa.
Fallonin mukaan borrelioosia sairastaville annetaan usein n. 3-viikon antibioottihoito ja heille sanotaan että mikäli hoidon jälkeen esiintyy vielä oireita ne ovat esim. psyykkisiä. Sairastuneet eivät joudu siis kohtaamaan ainoastaan vaikeaa sairautta monine oireineen, vaan myös oireiden väheksyntää.
Antibioottihoito saattaa auttaa, mutta valitettavasti se ei välttämättä tuo lopullista apua. Jotkut tulevat joksikin aikaa parempaan kuntoon mutta kuukausien kuluttua tauti saattaa uusiutua.Arviolta 30% sairastuneista tarvitsee toistuvia antibioottihoitoja. Hoitojen kesto ja laajuus on vielä selvittämättä.
HUOM! Borreliabakteerin kyvystä selvitä esim. antibioottihoidoista löytyy runsaasti tutkimuksia tämän viestiketjun 2 sivulta.
Myös suomalaiset tutkijat ovat huomanneet borreliabakteerin aiheuttavan osalle ihmisistä pitkäkestoisia oireita, joihin antibiootitkaan eivät tehoa. Bakteeri kykenee suojautumaan antibioottien vaikutuksilta piiloutumalla ja näin se pystyy kulkeutumaan eri puolille elimistöä. Se kykenee läpäisemään myös vaikeasti läpäistävissä olevat esteet kuten veri-kives- ja veri-aivoesteet. Päästyään näihin paikkoihin, bakteeri kykenee selviytymään pitkiä aikoja. Taudin uusiutuminen saattaa lähteä esim. näistä paikoista.
(Reactivation and immune evasion of Borrelia infection April 2005
http://www.lymenet.de/literatur/niches. ... om,%202005
http://sci.tech-archive.net/Archive/sci ... 01102.html
Tutkimus löytyy kokonaisuudessaan myös tämän viestiketjun lopusta.)
Piiloutuminen ei kuitenkaan näyttäisi olevan ainoa tapa, jonka avulla borreliabakteeri selviytyy immuunijärjestelmästä, antibiooteista yms. Useiden tutkimusten mukaan borreliabakteeri käyttää lukuisia erilaisia mekanismeja selviytyäkseen. Se muuntuu mm.kystamuotoon Tällöin immuunijärjestelmä, eivätkä useat antibiootit tunnista sitä. Nämä saattavat osaltaan selittää taudin uusiutumisen ja kroonistumisen.
Lääkäri Keith Berndtson esittää borreliabakteerin erilaisia selviytymiskeinoja mm. mikroskooppikuvien avulla:
http://parkridgemultimed.com/site/wp-co ... actice.pdf
Evidence-Based Lyme Disease Practice
Borreliabakteerin kystamuotoja on todettu eri tauteja sairastavien aivoista. Esim. seuraavassa tutkimuksessa Alzheimerin tautia sairastavan henkilön aivoista löytyi kystamuotoisia borreliabakteereita.
Concurrent neocortical borreliosis and Alzheimer's disease: Demonstration of a spirochetal cyst form. MacDonald, A.B.AnnalsNew YorkAcademy of Sciences, 1988;539:468-470.
In vivo finding of Borreliaburgdoreri cysts in an autopsy of a human brain. "An unexpected observation was the identification of cystic forms of the Borrelia spirochete in dark-field preparations of cultured hippocampus, and in imprints of hippocampus... A cystic form of the Borrelia spirochete would explain the ability of the microbe to persist in the host during a prolonged period of asymptomatic clinical latency, which spans the period between primary infection and the expression of tertiary manifestations of neuroborreliosis
Kystamuotoiset bakteerit:
ØysteinBrorson, Sverre-Henning Brorson: An in vitro study of the susceptibility of mobile and cystic forms of Borreliaburgdorferi to tinidazole.
INTERNATIONAL MICROBIOLOGY (2004) 7:139?142 http://www.im.microbios.org/26June04/09%20Brorson.pdf
The susceptibility of mobile and cystic forms of Borreliaburgdorferi to tinidazole (TZ) was examined. The minimal bactericidal concentration (MBC) of TZ against the mobile spirochetes was >128 µg/ml at 37°C in micro-oxic atmosphere when incubated for 14 days. TZ significantly reduced the conversion of mobile spirochetes to cystic forms during incubation. The MBC for older (10- months-old) cysts at 37°C in a micro-oxic atmosphere was >0.5 µg/ml, but >0.125µg/ml for young (1-day-old) cysts. Acridine orange staining, dark-field microscopy and transmission electron microscopy revealed that, when the concentration of TZ was ≥ MBC, the contents of the cysts were partly degraded, core structures did not develop inside the young cysts, and the amount of RNA in these cysts decreased significantly. When cysts were exposed to TZ, both the spirochetalstructures and core structures inside the cysts dissolved, and the production ofblebs was significantly reduced. These observations may be valuable in the treatmentof resistant infections caused by B. burgdorferi, and suggest that a combinationof TZ and a macrolide antibiotic could eradicate both cystic and mobile formsof B. burgdorferi. [IntMicrobiol2004; 7(2):139?142]
Epätyypillisiä borreliabakteerin muotoja: Atypical forms of Borreliaburgdorferi-clinical consequences
Zajkowska J, Hermanowska-Szpakowicz T, Rubel J. PolMerkuriuszLek. 2005 Jan;18(103):115-9.
Borreliaburgdorferi utilizes a variety of mechanisms to counteract eradication by its host and establish chronic infection. Wediscuss several of these mechanisms, including plasmid encoded genes, morphologic variants, cysts formation, coloniesformation, antigenic variation, and resistance to iron deprivation. These mechanisms, as well as the possible survival ofBorreliaburgdorferi in forms with low metabolic activity, may explain relapsing Lyme disease, and may, also account for thedifficulties with eradicating this pathogen.PMID: 15859564 begin_of_the_skype_highlighting 15859564 end_of_the_skype_highlighting [PubMed - in process]
Alla on esitetty muutamia tutkimuksia, joissa on todettu taudin kroonistuminen ja uusiutuminen antibioottihoidoista huolimatta:
Borrelia vasta-aineet ja PCr olivat negatiiviset. Vuotta myöhemmin arvot olivat vahvasti positiivset sen jälkeen kun henkilö oli saanut antibioottihoidot kefotaksiimilla ja minosykliinillä.
Liegner KB, Rosenkilde CE, Campbell GL, Guam TJ, Dennis DT. 1992. Culture-confirmed Treatment Failure of Cefotaxime and Minocycline in a Case of LymeMeningoencephalomyelitis in the US. V Int Conf LymeBorreliosis Abstract #63. Paired CSF and serum tests for antibodies to Bb and PCR for Bbspecificoligonucleotides in CSF were negative. Eleven months later, after treatment with cefotaxime and minocycline, a T-cell stimulation test with Bb antigens was strongly positive. A year later, paired serum and CSF samples were strongly positive for antibodies to Bb and CSF was culture positive.
Mac Donaldin ym. tutkimuksen mukaan Borrelioosi saattaa aktivoitua uudelleen aiemmista antibioottihoidoista huolimatta. Oireettomien/oireellisten kausien vaihtelu viittaa siihen, että bakteeri kykenee selviytymään elimistössä pitkiä aikoja. Spirokeetta kasvaa hitaasti ja sen vuoksi suositusten mukaiset antibioottihoidot saattavat olla riittämättömät.
Clinical implications of delayed growth of the Lymeborreliosis spirochete, Borreliaburgdorferi.
MacDonaldAB; Berger BW; Schwan TG
Acta Trop 1990 Dec;48(2):89-94
Lymeborreliosis, a spirochetal infection caused by Borreliaburgdorferi, may become clinically active after a period of latency in the host. Active cases of Lyme disease may show clinical relapse following antibiotic therapy. The latency and relapse phenomena suggest that the Lyme disease spirochete is capable of survival in the host for prolonged periods of time. We studied 63 patients with erythemamigrans, the pathognomoniccutaneous lesion of Lymeborreliosis, and examined in vitro cultures of biopsies from the active edge of the erythematous patch. Sixteen biopsies yielded spirochetes after prolonged incubations of up to 10.5 months, suggesting that Borreliaburgdorferi may be very slow to divide in certain situations. Some patients with Lymeborreliosis may require more than the currently recommended two to three week course of antibiotic therapy to eradicate strains of the spirochete which grow slowly.
Oksin ym. (1999) tutkimuksessa todettiin borrelioosin uusiutuneen pitkistä antibioottihoidoista huolimatta. Henkilö sai antibiootteja 47 viikkoa (11kk), joista suonensisäistä keftriaksonia 7 viikkoa. Diagnoosi oli vahvistettu koepalalla. Oireet palasivat 44 viikkoa hoidon päättymisestä. Toisen henkilön oireet uusiutuivat 130 viikkoa sen jälkeen kun hän oli saanut 16 viikon antibioottihoidot. Vasta-ainetesti oli alussa positiivinen, mutta oireiden uusiuduttua negatiivinen. Tästä huolimatta PCR oli positiivinen!
Oksi J, Marjamaki M, Nikoskelainen J, Viljanen MK. 1999. Borreliaburgdorferidetected by culture and PCR in clinical relapse of disseminated Lymeborreliosis. Ann Med 31(3):225-32. One patient had been treated for as long as 47 weeks (11 months) including 7 weeks of intravenous ceftriaxone ? primary diagnosis was confirmed by positive biopsy and the relapse 44 weeks after treatment confirmed by a positive plasma PCR. 1 patient had relapse 130 weeks after 16 weeks of treatment. Pt. was seropositive initially but seronegative at relapse. Relapse confirmed by positive PCR, no history of reinfection.
Henkilöllä oli krooninen niveltulehdus polvessa 7 vuoden ajan useista antibioottihoidoista huolimatta.
Battafarano DF, Combs JA, Enzenauer RJ, Fitzpatrick JE. 1993. Chronic septic arthritis caused by Borrelia
burgdorferi. ClinOrthop 297: 238-41. ?A patient had chronic septic Lyme arthritis of the knee for 7 years despite multiple antibiotic trials and multiple arthroscopic and open synovectomies. Spirochetes were documented in synovium and synovial fluid.?
Pernassa spirokeettoja antibioottihoidosta huolimatta:
Cimmino MA, Azzolini A, Tobia F, Pesce CM. 1989. Spirochetes in the spleen of a patient with chronic Lyme disease. Am J ClinPathol 91(1): 95-7. ?G-penicillin treatment was ineffective?. Borrelia-like spirochetes were identified histologically in the spleen.?
Fibroblastit ym solut suojelevat spirokeettoja antibiootilta (keftriaksoni) ja mahdollistavat näin spirokeetan selviämisen elimistössä antibioottihoidoista huolimatta:
Georgilis K, Peacocke M, and Klempner MS. 1992. Fibroblasts protect the LymeDisease spirochete, Borreliaburgdorferifrom ceftriaxone in vitro. J. Infect Dis 166:440-444. ?Fibroblasts protected B.burgdorferifor at least 14 days of exposure to ceftriaxone.? Other cell types also protected Bb, contributing to its long-term survival.
Suonikalvontulehdus silmissä, sydän-, nivel- ja jännetulehdus henkilöllä, jolla borrelioosi uusiutui toistuvasti antibioottihoidoista huolimatta. Jänteistä otetuista koepaloista löytyi borreliabakteereita.
Haupl T, Hahn G, Rittig M, Krause A, Schoerner C, Schonnherr U, Kalden JR, Burmester GR. 1993. Persistence of Borreliaburgdorferiin ligamentous tissue from a patient with chronic LymeBorreliosis.ArthrRheum ;36:1621-26. The patient had relapsing Lymeborreliosis, with choroiditis, arthritis, carditis, and tendinitis. Repeated antibiotic treatment was necessary to stop the progression of disease, but did not completely eliminate Bb from all sites of infection. Viable Bb was cultured from a ligament sample obtained surgically.
Toistuva ihomuutos pitkästä antibioottihoidosta huolimatta (minosykliini). Hoitojen jälkeen henkilön ELISA-vasta-ainetesti oli negatiivinen mutta PCR positiivinen ja ihosta otetussa koepalassa oli borreliabakteereita. Myöhemmin annettu hoito auttoi ihomuutokseen.
Liegner KB, Shapiro JR, Ramsay D, Halperin AJ, Hogrefe W. & Kong L. 1993. Recurrent erythemamigrans despite extended antibiotic treatment with minocycline in a patient with persisting Borreliaburgdorferiinfection. J Am AcadDermatol 28:312-314. Patient was ELISA-negative after treatment, but blood was PCR-positive and Bb-compatible structure was visualized in skin biopsy. Furthertreatmentresolved EM.
Borreliabakteereista osa selviää elossa makrofagien sisällä hoidoista huolimatta
Montgomery RR, Nathanson MH, Malawista SE. 1993. The fate of Borreliaburgdorferiin mouse macrophages: destruction, survival, recovery. J Immunol 150(3):909-15. ?The macrophage is a known reservoir for a number of infectious agents, and is therefore a likely candidate site for persistence of Bb?. Although the large majority of spirochetes within a given cell were dead, we saw occasional live ones?and can reculture [them].?
Viiden henkilön oireet uusiutuivat 12- 14 päivää antibioottihoitojen lopettamisen jälkeen.
PreacMursic V, Marget W, Busch U, PleterskiRigler D, Hagl S. 1996. Kill kinetics of Borreliaburgdorferiand bacterial findings in relation to the treatment of Lymeborreliosis. Infection 24(1): 9-16.Persistence of B. burgdorferis.l. and clinical recurrences in patients despite antibiotic treatment.Cultureconfirmedrelapsesafter12-14daystreatmentcourses in 5 patients.
Kuukauden antibioottihoito (doksisykliini) vähensi borrelioosia sairastavien koirien oireita mutta ei kyennyt tuhoamaan bakteeria lopullisesti. Vasta-ainepitoisuudet laskivat, mutta kuuden kuukauden kuluttua hoitojen lopettamisesta, ne alkoivat nousta uudelleen. Syynä oli todennäköisesti elimistön vasta-ainereaktio uusia spirokeettoja kohtaan.
Straubinger RK, Summers BA, Chang YF, Appel MJ. 1997. Persistence of Borreliaburgdorferiin experimentally infected dogs after antibiotic treatment. J ClinMicrobiol 35(1): 111-6. ?Treatment with high doses of amoxicillin or doxycycline for 30 days diminished but failed to eliminate persistent infection.? Antibody titers fell, but 6 months after antibiotic treatment was discontinued, ?antibody levels began to rise again, presumably in response to proliferation of the surviving pool of spirochetes.?
---------------------------------------------------------------------------------
Sivulla http://www.lymediseaseaction.org.uk/art ... stence.htm on lukuisia tutkimuksia joissa on esitetty borrelioosin kroonistuminen.
-----------------------------------------------------------------------------
"Useissa tutkimuksissa on osoitettu Borrelioosin kroonistuminen. Esim. neljä Kansallisen Terveysinstituutin (NIH) tutkimusta totesi kroonisen Borrelioosin olevan tosiasia ja taudinkuvan vakavan. Tutkimustiedosta huolimatta osa lääkäreistä kieltää taudin kroonistumiseen."(2010)
Interdiscip Perspect Infect Dis. 2010;2010:876450. Epub 2010 May 25.
Proof that chronic lyme disease exists.
Cameron DJ.
Department of Medicine, Northern Westchester Hospital, Mt. Kisco, NY 10549, USA.
The evidence continues to mount that Chronic Lyme Disease (CLD) exists and must
be addressed by the medical community if solutions are to be found. Four
National Institutes of Health (NIH) trials validated the existence and severity
of CLD. Despite the evidence, there are physicians who continue to deny the
existence and severity of CLD, which can hinder efforts to find a solution.
Recognizing CLD could facilitate efforts to avoid diagnostic delays of two years
and durations of illness of 4.7 to 9 years described in the NIH trials. The risk
to society of emerging antibiotic-resistant organisms should be weighed against
the societal risks associated with failing to treat an emerging population
saddled with CLD. The mixed long-term outcome in children could also be
examined. Once we accept the evidence that CLD exists, the medical community
should be able to find solutions. Medical professionals should be encouraged to
examine whether: (1) innovative treatments for early LD might prevent CLD, (2)
early diagnosis of CLD might result in better treatment outcomes, and (3) more
effective treatment regimens can be developed for CLD patients who have had
prolonged illness and an associated poor quality of life.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20508824 [PubMed - in process]
-----------------------------------------------------------------------------
Biofilmi suojaa borrelia-bakteeria immuunipuolustukselta ja antibiooteilta
S. Juvonen TTT
24.4.2010
Borrelia-bakteerilla on useita keinoja välttää immuunipuolustus ja ulkoisia uhkia kuten antibioottihoitoja. Tämänhetkisistä suojautumismekanismeista tunnetuimmat ovat kystamuotoon muuntuminen, toinen on biofilmin muodostaminen.
Mitä biofilmit ovat?
Biofilmit ovat monimutkaisia eri mikrobien muodostamia yhdyskuntia jotka ovat suojautuneet ympäristön uhkia vastaan tehokkaasti. Biofilmiyhdyskunnan bakteerit tuottavat ympärilleen limaa. Limakerros helpottaa biofilmi-bakteerien kiinnittymistä eri pintamateriaaleihin, ja se ylläpitää biofilmin rakennetta. Muodostelmia löydetään ihmiselimistöstä, mutta myös kaikkialta muualtakin missä kiinteä aine ja nesteet yhdistyvät luonnossa, sairaaloissa, tehtaissa jne.
Biofilmin muodostuminen on monimutkainen prosessi, joka vaatii bakteereilta vuorovaikutuksia ja kommunikointia eri mikrobisolujen välillä. Tutkimuksissa on osoitettu biofilmien olevan hyvin organisoituneita sienimäisiä rakennelmia, joissa mikrobisolut ovat löyhästi pakkautuneina. Biofilmien arvioidaan olevan bakteerien yleisin elintapa biosfäärissä: n. 99 % kaikista luonnon bakteerisoluista kasvaa biofilmeissä.
Biofilmit voivat muodostua yhdestä tai useasta bakteerilajista. Bakteerien lisäksi biofilmeissä esiintyy sieniä, leviä, hiivoja ja alkueläimiä sekä erilaisia orgaanisia ja epäorgaanisia yhdisteitä. Vaikka monilajiset biofilmit ovat vallitsevia useimmissa ympäristöissä, yksilajiset biofilmit ovat yleisiä monissa infektioissa ja lääketieteellisten laitteiden pintoihin muodostuvissa biofilmeissä .
Tiedetään, että biofilmin solut eroavat vapaana olevista soluista suuresti. Ne vaihtavat geneettistä tietoa keskenään, niiden proteiinien muodostuminen on erilaista ja ne ovat erittäin vastustuskykyisiä antibiootteja ja immuunipuolustusta vastaan. Biofilmi-bakteerit erittävät ympärilleen ainetta, joka suojaa niitä tehokkaasti elimistön puolustustekijöiltä. On arvioitu, että esim. 1 milligramma plakkia sisältäisi n.sata miljoonaa bakteerisolua.
Biofilmi suojaa mikrobeja myös. valolta, kuivumiselta, äärilämpötiloilta ja pesu- ja antimikrobisilta aineilta. Biofilmissä elämisen etuna on parempien ruoan- ja energianlähteiden lisäksi geneettisen materiaalin vaihtamisen helppous biofilmin sisällä. Tämä mahdollistaa paremmin sopeutuneiden bakteerilajikkeiden syntymisen.
Biofilmi-yhdyskunnat voivat läpikäydä geneettisiä mutaatioita muuttaakseen herkkyyttään antimikrobeja kohtaan ja ne voivat toimia infektion "varastoina", joista aika ajoin vapautuu yksittäinen elinkykyinen bakteerisolu. Viikon ikäinen biofilmi on ?täysi-ikäinen?. Tällöin tarvitaan useampi sata- jopa tuhatkertaiset määrät antibiootteja niiden tuhoamiseksi.
Biofilmi-bakteerien aiheuttamat infektiot?
CDC:n ja Kansallisen Terveysinstituutin (NIH) mukaan biofilmit ovat osallisena yli 80%:ssa tapauksista joissa potilaalla on jokin krooninen infektio esim. korvatulehdukset, ruoansulatuskanavan haavaumat, virtsatietulehdukset, prostatatulehdukset, hengitystietulehdukset (poskiontelot, kystinen fibroosi jne).
Ongelmana on immuunipuolustus joka kroonisissa tulehduksissa yrittää hävittää taudinaiheuttajat mutta ei pysty tekemään sitä. Mitä kauemmin infektiotilanne jatkuu, sitä enemmän tuhoa tapahtuu myös infektiota ympäröivissä kudoksissa. Tämä johtuu siitä että immuunipuolustus vapauttaa erilaisia toksisia yhdisteitä yrittäessään tuhota taudinaiheuttajia. Niillä ei kuitenkaan ole mitään vaikutusta biofilmeihin. Toksiinit voivat sen sijaan tuhota ympärillä olevia kudoksia.
Alzheimer-tutkijat ovat havainneet bakteerien käyttävän amyloideja, liimamaisia proteiineja, kiinnittyäkseen elimistön soluihin ja muodostaakseen bakteeriyhdyskuntia, biofilmejä. Amyloideja muodostuu keskushermostossa useissa neurologisissa sairauksissa kuten Parkinson- ja Alzheimerin-tauti. Biofilmejä muodostuu myös virtsateissä ja ne ovatkin todennäköinen syy kroonisiin virtsatietulehduksiin.
Ruotsalaisten tutkijoiden mukaan esim. naiset jotka saavat toistuvia virtsatietulehduksia kärsivät todennäköisesti yhdestä biofilmibakteerien aiheuttamasta infektiosta joka on resistentti hoidoille. Virtsatieinfektiot ovat useimmiten E.colin aiheuttamia. E.coli muodostaa amyloideja, mutta sen lisäksi ns. curleja ja pilejä. Ne ovat tietyntyyppisiä kuituja jotka vahvistavat biofilmimuodostelmaa. Tutkijat etsivät parhaillaan valmisteita biofilmien muodostumisen estämiseksi ja tuhoamiseksi. Ongelmana on löytää valmiste joka kohdistuu ainoastaan toksisiin amyloideihin.
(Alzheimer?s study leads to better drug for infections Medical news Today 25th November 2009.)
Esimerkkejä erilaisten biofilmi-bakteerien aiheuttamista infektioista ihmisissä (Loisa 2001,Costerton ym.1999)
Infektio tai sairaus/ Yleiset bakteerilajit biofilmissä
Hammasmätä Asidogeeniset grampositiiviset kokit
(esim. Streptococcus)
Periodontiitti (hampaiden tuki- Gramnegatiiviset anaerobiset suun bakteerit
kudoksen tulehdus)
Otitis media (korvatulehdus) Haemophilus influenzae (tietyt kannat)
Tuki- ja liikuntaelinten tulehdukset Grampositiiviset kokit (esim. Stafylokokki)
Necrotizing fasciitis (lihaskudoksen Ryhmän A streptokokki
ja peitinkalvon tulehdus; johtaa kuolioon)
Sappitiehyen tulehdus Enteeriset bakteerit (esim. Escherichia coli)
Osteomyeliitti Useita bakteeri- ja sienilajeja ? usein sekaisin
Eturauhastulehdus (bakteerin E. coli ja muut gramnegatiiviset bakteerit)
Sydänläpän tulehdus Viridans?ryhmän streptokokit
Kystisen fibroosin aiheuttama keuhkokuume P. aeruginosa ja Burkholderia cepacia
Meloidosis Pseudomonas pseudomallei
Keuhkokuume Gramnegatiiviset sauvat
Arteriovenöösit shuntit (epänormaali S. epidermidis ja Staphylococcus aureus yhteys valtimoiden ja laskimoiden välillä)
Schleral buckles (silmän sairaus) Grampositiiviset kokit
Peritoneaalisesta dialyysistä seurannut
peritoniitti (vatsakalvon tulehdus) Useat bakteeri- ja sienilajit
Virtsarakkotulehdus, kystiitti E. coli ja muut gramnegatiiviset sauvat
Lääketieteelliset laitteet
Sappitiehyeen asetetun muoviputken tukkeuma Useat eri enteeriset bakteerit ja sienet
Tikit Staphylococcus epidermidis ja S. aureus
Piilolinssit P. aeruginosa ja grampositiiviset kokit
Kierukat Actinomyces israelii ja monet muut
Hickman katetrit S. epidermidis ja C. albicans
Laskimokatetrit S. epidermidis ja muut
Mekaaniset sydänläpät S. aureus ja S. epidermidis
Intubaatioletkut Useita eri bakteeri- ja sienilajeja
Verisuonisiirteet Grampositiiviset kokit
Ortopediset laitteet S. aureus ja S. epidermidis
Borrelia-bakteeri on tunnetusti ns. pleomorfinen bakteeri. Se kykenee mukautumaan epäsuotuisiin elinolosuhteiisiin muuntumalla. Bakteeri suojautuu niiden avulla stressitilanteita kuten antibiootteja vastaan. Yksi bakteerin käyttämistä suojautumismekanismeista on ns. kystamuoto. Toinen bakteerin käyttämistä suojamekanismeista on biofilmi. Borrelia-bakteerin suojautuminen biofilmin sisälle saattaa osaltaan selittää kroonista Borrelioosia sairastavien jatkuvat oireet.
Kystamuoto on resistentti useimmille tavanomaisille antibiooteille. Jotkut antibiootit ovat tehokkaita vapaana oleviin bakteereihin ja osa tuhoaa myös kystamutoja. Kuitenkin monien oireet jatkuvat hoidosta huolimatta eikä hoidoista aina ole merkittävää apua. Syynä siihen saattavat olla Biofilmiyhdyskunnat jotka ovat yli 1000 kertaa vastustuskykyisempiä antibiootteja vastaan kuin vapaana olevat bakteerit.
(Novel Fugitive Strategy for Borrelia burgdorferi: Biofilm ja An in vitro evaluation of antibiotic susceptibility of different morphological forms of Borrelia burgdorferi. Kaur Navroop ym.)
VIDEO: Biofilmissä eläviä borrelia-bakteereja:
http://www.youtube.com/watch?v=a4uNDWdChM8
Biofilmi-bakteerien hoidossa esiintyviä ongelmia
Loisa ( 2001) mainitsee useita syitä Biofilmien tuhoamiseen liittyvistä ongelmista.
Biofilmejä muodostuu esim. hampaisiin, ikeniin, keuhkoihin, korviin ja virtsateihin. Biofilmit kasvavat yhdessä tai useassa kohdassa, ja biofilmi-infektioille on tyypillistä selvien oireiden hidas ilmeneminen. Arvellaan, että jopa 65 %:iin kaikista ihmisen bakteeri-infektioista liittyy biofilmin muodostuminen.
Ihmisen elimistö puolustautuu jatkuvasti vieraita pieneliöitä, kuten bakteereja, vastaan mm. syöjäsolujen (neutrofiilit ja makrofagit) avulla. Syöjäsolut tuhoavat elollisia ja elottomia kappaleita fagosytoimalla ja hajottamalla ne entsyymeillään.?
?Biofilmit, jotka ovat fagosyyteille vastustuskykyisiä, vetävät niitä kuitenkin puoleensa. Siitä huolimatta, että fagosytoosi ei toimi, vapauttavat fagosyytit biofilmin kohdatessaan entsyymejään. Nämä entsyymit voivat vaurioittaa kudosta biofilmin ympärillä. Biofilmistä vapautuu myös entsyymien toiminnan johdosta yksittäisiä bakteereja, jotka voivat sitten aiheuttaa viereisessä vaurioituneessa kudoksessa infektion. Toisaalta biofilmin bakteerisolut vapauttavat myös antigeenejä ja stimuloivat siten vasta-aineiden tuottoa. Tässäkään tapauksessa puolustusmekanismin toiminta ei ole täydellistä.?
?Elimistön vapauttamat vasta-aineet pystyvät tappamaan ainoastaan yksittäisiä bakteereja. Ne eivät ole tehokkaita biofilmin bakteereja vastaan. Näin ollen edes hyvän humoraalisen ja sellulaarisen immuunisysteemin omistavilla ihmisillä harvoin pelkkä luonnollinen puolustusjärjestelmä yksinään pystyy selvittämään biofilmi-infektion.?
?Antibioottihoitokin vaikuttaa vain vapaisiin ja biofilmistä vapautuviin bakteereihin. Se ei yleensä tapa itse biofilmiä. Tästä syystä biofilmi-infektioihin kuuluvat uusiutuvat oireet useidenkin antibioottihoitojen jälkeen.?
?Reaktiiviset hapettimet, kuten hypokloriitti ja vetyperoksidi, deaktivoituvat
biofilmin ulkokerroksissa, ennen kuin ne pääsevät diffundoitumaan koko
biofilmin läpi. Nämä antimikrobiset hapettimet ovat fagosyyttisolujen
käytössä, ja niiden huono tunkeutumiskyky biofilmiin voikin osittain olla syynä
siihen, etteivät fagosyyttisolut pysty tuhoamaan biofilmiä (Costerton ym.,
1999). Lisäksi biofilmin ulkopinnan negatiivisesti varautunut eksopolysakkaridi on
erittäin tehokas suojaamaan mikrobisoluja positiivisesti varautuneilta
aminoglykosidi-antibiooteilta (streptomysiini, neomysiini, gentamysiini jne).
Pienten antimikrobisten molekyylien tapauksessa polysakkaridimatriksi
ainoastaan lykkää biofilmin solujen kuolemaa eikä niinkään toimi tehokkaana
suojana.?
?Osa biofilmin mikrobeista elää niukkaravinteisessa ympäristössä, joten niiden
kasvu on hidasta. Käytännössä kaikki antimikrobiset aineet ovat
tehokkaampia tappamaan nopeasti kasvavia soluja. Joidenkin antibioottien
toiminnalle solukasvu on jopa välttämätöntä; mm. penisilliini ja ampisilliini
eivät tapa ei-kasvavia soluja ollenkaan.?
?Sefalosperiinit, aminoglykosidit ja fluorokinolonit taasen pystyvät tappamaan kasvamattomia soluja, mutta ne ovat selvästi tehokkaampia tappamaan nopeasti jakautuvia soluja. Tutkimuksissa on kuitenkin selvinnyt, että biofilmin resistenttiyttä ei voida yksin selittää hidastuneen kasvun avulla, vaan hidastunut kasvunopeus
antaa biofilmille lisäsuojaa antimikrobisia aineita vastaan.?
Useat antibiootit ovat täysin tehottomia biofilmi-bakteeri-infektion hoitoon. Niistä on päinvastoin haittaa sillä bakteerit kommunikoivat biofilmin sisällä keskenään ja yrittävät löytää ratkaisun miten antibiootti saataisiin tehottomaksi.
http://www.youtube.com/watch?v=XVJ6FQTI ... re=related
TUTKIMUKSEN NYKYHETKI
Biofilmien muodostumisen taustalla olevia säätelymekanismeja ei juurikaan tunneta. Jotta biofilmi-mikrobit kyettäisiin tuhoamaan, on ymmärrettävä niiden syntymekanismeja ja käyttäytymistä.
1.Tiettyjä geneettisiä markkereita seuraamalla on pystytty seuraamaan biofilmien muodostumista.
(Expression Profile of Quorum Sensing Biomarkers during Biofilm Development in Borrelia burgdorferi.)
2. New Yorkissa, Binghamptonin yliopiston tutkijat ovat löytäneet tekijöitä jotka edesauttavat biofilmien syntymistä.
Tutkimuksessa selvitettiin:
1. Voimmeko voittaa biofilmit?
2. Voimmeko vaikuttaa biofilmien antibioottiresistenssiin?
3. Voimmeko löytää ratkaisun biofilmimuodostelmien synnyn ehkäisemiseksi ja estää niiden tulemisen antibiooteille resistenteiksi?
Joidenkin viimeaikaisten tutkimusten mukaan se on mahdollista.
Sauer selvitti biofimien muodostumiseen vaikuttavia säätelymekanismeja ja löysi hiljattain yhden mekanismin joka näytti olevan vastuussa antibioottiresistenssistä. Tulevaisuudessa on mahdollista vaikuttaa resistenssin syntymiseen joko vahvistamalla tai heikentämällä tätä säätelymekanismia. Pyrkimyksenä on saada biofilmit sellaiseen muotoon jossa ne on helpompi tuhota. Erilliset bakteerit on biofilmi-bakteereita huomattavasti helpompi tuhota.
(Researchers smoke out secrets of the ?biofilms? that help chronic infections dig in. Binghamton University, State University of New York, news release Dec 18, 2009)
3. Borrelioosi-biofilmitutkija
professori Eva Sapi
http://www.newhaven.edu/unhtoday/archiv ... ofile.html
Tohtori Eva Sapi on solu-ja molekyylibiologian professori joka sairastui Borrelioosiin. Omien vaikeiden kokemustensa vuoksi hän vaihtoi aiemmin tekemänsä syöpätutkimuksen Borrelioositutkimukseen.
Punkinpureman jälkeen hänelle ilmaantui aivoturvotusta ja useita Borrelioosiin sopivia oireita kuten kävelyvaikeuksia. Laboratoriotestit olivat kuitenkin negatiiviset. Professori Sapi kävi usean lääkärin luona oman tartuntansa vuoksi. Useat heistä vain nauroivat hänelle. Monet tautiin sairastuneet joiden testitulokset ovat olleet negatiiviset, ovat joutuneet kokemaan vastaavanlaista kohtelua. Se sai Sapin toimimaan.
"Tutkijat eivät juurikaan tunne Borrelioosia", hän sanoo. Tutkimuksissaan Sapi huomasi nopeasti punkkien kantavan usein muitakin taudinaiheuttajia kuten mykoplasmaa. Nyt hänen laboratoriossaan on lukuisia tutkijoita. He huomasivat että parhainkin borrelioositesti on erittäin epäluotettava. Se antaa virheellisesti negatiivisen tuloksen jopa 70%:ssa borrelioositapauksia. Siksi Sapi tutkijaryhmineen tutkii parhaillaan esim. nanoteknologian mahdollisuuksia luotettavamman borrelioositestin kehittelyssä.
Tri Sapi hoitaa itseään kokonaisvaltaisesti. Hän kävi äskettäin mm. naturopaatin vastaanotolla ja sai hoidoista apua. "Tarvitsen aivojani, en voi ylenkatsoa mitään hoitomuotoa."
Sapi tutkijakollegoineen selvittää parhaillaan mitä kemiallisia prosesseja bakteerit käyttävät muodostaessaan biofilmejä. He toivovat löytävänsä menetelmän jolla biofilmien muodostuminen pystytään estämään. Hän testaa myös useita entsyymejä ja tekniikoita joilla olemassa olevat biofilmit saataisiin hajotettua. Hän on aiemmissa tutkimuksissaan havainnut borrelia-biofilmien muodostuvan kalsiumia sisältävistä ?kristalleista?. Hän epäilee että ne ovat syynä monien Borrelioosia sairastavien niveloireisiin.
......................................................................................................
http://p1.foorumi.info/lymeborrelioosi/ ... =4176#4176
Videolla http://www.youtube.com/watch?v=a4uNDWdChM8
tutkija näyttää mikroskooppikuvaa borreliabakteerien kerääntymisestä ryhmäksi ns. biofilmin suojaan. Biofilmit näyttävät olevan yksi selitys taudin kroonistumiselle ja hoitojen epäonnistumiselle.
----------------------------------------------------------------------------------
Pauliina Hartialan väitös borrelioosista 2009. Tutkimuksissa todettiin borreliabakteerin pakenevan immuunipuolustusta useilla eri tavoilla.
https://oa.doria.fi/bitstream/handle/10 ... sequence=1
IMMUNE EVASION BY BORRELIA BURGDORFERI ? WITH SPECIAL REFERENCE TO CD38-MEDIATED CHEMOTAXIS OF NEUTROPHILS AND DENDRITIC CEL
by Pauliina Hartiala
TURUN YLIOPISTON JULKAISUJA
ANNALES UNIVERSITATIS TURKUENSIS
SARJA - SER. D OSA - TOM. 835
MEDICA - ODONTOLOGICA
-----------------------------------------------------------------------
Kaksi suomalaista tutkimusta joissa borreliabakteerin todettiin selviýtyvän antibioottihoidoista huolimatta.
1. Borrelia-bakteeri suojautuu antibiooteilta
Suomen Akatemian tiedote 4.6.2008
http://www.aka.fi/fi/A/Suomen-Akatemia/ ... iooteilta/
Punkin levittämä Borrelia-bakteeri suojautuu antibiooteilta
Lymen borrelioosia aiheuttava Borrelia-bakteeri on taitava suojautumaan antibiooteilta. Koetilanteessa se säilyi hengissä piiloutumalla hiiren nivelkudokseen. ?Bakteeri voi olla piilossa jopa useita viikkoja ja tulla esille antibioottihoidon jälkeen. Hoidon jälkeen Borrelian DNA:ta löytyy kuitenkin vain nivelkudoksesta, kun ennen hoitoa sitä löytyy lähes kaikkialta elimistöstä?, professori Matti K. Viljanen Turun yliopistosta sanoo.
Suomen Akatemian rahoittamassa tutkimuksessa on Viljasen johdolla pyritty selvittämään, miten borrelia onnistuu väistämään immuunipuolustuksen ja leviämään ihosta eri elimiin. Samalla on tutkittu, miten borrelioosin antibioottihoitoon reagoimaton krooninen ja vaikeastikin invalidisoiva tautimuoto syntyy. ?Ei kuitenkaan voida olla varmoja siitä, että ihmisillä taudin krooniset oireet välttämättä perustuvat samoihin mekanismeihin kuin hiirillä, vaikka bakteeria onkin löydetty hoidetuista potilaista. Noin 10 prosentilla potilaista niveloireet jatkuvat antibioottihoidosta huolimatta.?
Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa
Borrelia-bakteeri aiheuttaa maailmanlaajuisesti merkittävintä punkkien levittämää tautia, Lymen borrelioosia. Euroopassa tautitapauksia on vuosittain kymmeniä tuhansia ja Suomessa muutamia tuhansia. ?Bakteeria levittävät punkit, joita Suomessa kutsutaan puutiaisiksi. Punkkeja on runsaasti Ahvenanmaalla, muualla saaristossa ja Etelä-Suomen rannikolla. Paikoitellen punkkeja esiintyy aina napapiirin korkeudella asti. Punkkien borreliakantajuudet vaihtelevat suuresti. Tutkimuksemme mukaan Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa?, Viljanen kertoo.
?Taudin alkuvaiheessa punkin pureman mukana ihmisen ihoon siirtyneet bakteerit leviävät ihossa aiheuttaen taudille tyypillisen rengasmaisesti laajenevan punoittavan ihottuman. Monilla infektio rajoittuu ihoon ja paranee itsestään. Osalla potilaista borrelia kuitenkin väistää immuunipuolustuksen ja leviää ilman antibioottihoitoa eri elimiin ja voi aiheuttaa kroonisen taudin. Selvitämme parhaillaan, voidaanko eri antibiooteilla, pitkällä hoidolla tai antibiootteja yhdistelemällä borrelia tuhota sen piiloutumisyrityksistä huolimatta?, Viljanen sanoo.
Lisätietoja
- bakteeriopin professori Matti K. Viljanen, p. (02) 333 7330, matti.viljanen (at) utu.fi
Suomen Akatemian viestintä
tiedottaja Outi Jalonen
p. (09) 7748 8327, 040 359 2936
outi.jalonen (at) aka.fi
2. Suomalainen tutkimus: Borrelioosi vaikuttaa useisiin elimiin ja aiheuttaa lukuisia oireita. Tauti kroonistuu joillakin antibioottihoidoista huolimatta ja aiheuttaa psysyviä vaurioita. Bb näyttäisi vaikuttavan dendriittisolujen toimintaan haitallisesti ja estää siten immuunipuolustuksen toimintaa.
J Leukoc Biol. 2007 Apr 17; [Epub ahead of print]
Transcriptional response of human dendritic cells to Borrelia garinii--defective CD38 and CCR7 expression detected.
Hartiala P,
Hytonen J,
Pelkonen J,
Kimppa K,
West A,
Penttinen MA,
Suhonen J,
Lahesmaa R,
Viljanen MK.
*Department of Medical Microbiology and Turku Graduate School of Biomedical Sciences, University of Turku, Finland; Turku Centre for Biotechnology, Turku, Finland; and Department of Medicine, Helsinki University Central Hospital, Helsinki, Finland.
Lyme borreliosis is a disease, which can affect several organs and cause a variety of symptoms. In some patients, the infection may become chronic, even after antibiotic therapy, and cause persisting damage. Dendritic cells (DC) are involved in the initiation of innate and adaptive immune responses. To study interactions between Borrelia garinii (Bg), one of the causative agents of Lyme borreliosis, and human DC, we used a cDNA microarray to compare the Bg-induced DC transcriptional response with the response induced by LPS.
The Bg-induced response consisted of a smaller number of genes than the LPS-induced response. The microarray showed that the ectoenzyme CD38, which has an important role in DC chemotaxis and migration to lymph nodes, was strongly up-regulated by LPS but practically not at all by Bg.
This finding was confirmed with quantitative RT-PCR and with flow cytometry at the protein level. In addition, RT-PCR showed that CCR7 expression was 11-fold greater in LPS-stimulated than in Bg-stimulated cells. These findings suggest that Bg may affect crucial DC functions by blocking the up-regulation of important molecules in DC migration to lymph nodes, thus affecting further immune responses in Lyme borreliosis infection.
PMID: 17440035 [PubMed - as supplied by publisher]
-------------------------------------------------------------------------
Suomalainen tutkimus: "Borrelioosin aiheuttava bakteeri kykenee aiheuttamaan kroonisen eri puolille elimistöä leviävän infektion"
Molecular Immunology
Johanna Pietikäinen, et al
Abstract
The Lyme disease spirochetes, Borrelia burgdorferi sensu stricto, Borrelia afzelii and Borrelia garinii, are tick-borne pathogens that can cause chronic disseminated infections. To survive in the human host borreliae need to evade the immune system. It is already well known that B. burgdorferi ss. and B. afzelii bind the complement (C) alternative pathway inhibitor factor H from serum using OspE and CRASP-1/Bba68 proteins to escape C attack. In the presence of natural antibodies and in chronic infections, when specific antibodies develop, borreliae have to protect themselves from antibody-induced classical pathway C attack. In this study we demonstrate binding of the classical pathway inhibitor, C4b-binding protein (C4bp), to three genospecies of B. burgdorferi sensu lato. Binding was strongest to B. garinii, which has been found to be the weakest factor H binder. The bacteria bound both purified 125I-labeled C4bp and C4bp from serum. Unlabeled C4bp competed for binding with 125I-C4bp, whereas BSA had no effect. Binding was salt-sensitive and inhibited by C4b and partially by heparin. C4bp maintained its cofactor activity for factor I in cleaving C4b when bound to the bacterial surface. Ligand blotting analysis of whole cell lysates and fractionated outer cell membranes of the bacteria suggested one major receptor of approximately 43 kDa (P43) for C4bp in B. garinii and B. burgdorferi sensu stricto. Binding of C4bp may thus allow Lyme disease borreliae to escape activation of the classical C pathway and allow chronic infections in humans even in the presence of specific antibodies.
Keywords: Innate immunity; Infection; Immune evasion
Abbreviations: C4bp, C4b-binding protein; C, complement; CP, classical pathway; AP, alternative pathway; MAC, membrane attack complex; FHL-1, factor H-like protein 1; CNS, central nervous system; SCR, short consensus repeat; BSA, bovine serum albumin; FI, factor I; NHS, normal human serum; HI-NHS, heat-inactivated NHS; ECL, enhanced chemiluminescence
Viimeksi muokannut soijuv, Ke Huhti 18, 2012 20:15. Yhteensä muokattu 11 kertaa.
1. "Kliinisten tutkimusten mukaan kroonista borrelioosia sairastavien oireet ovat usein voimakkaasti elämänlaatua heikentäviä. Tätä kantaa edustavat esim. Kansainvälisen Borrelioosijärjestön ILADSin tutkijat/lääkärit. Amerikkalaisten infektiolääkärien yhdistys, IDSA, sen sijaan on sitä mieltä, että krooniset oireet ovat vain pieniä kipuja ja kremppoja. Kroonisessa borrelioosissa esiintyy esim. seuraavia oireita: päänsärky, nivelkivut, muisti-ja keskittymisongelmat, voimakas väsymys jne."
Med Hypotheses. 2008 Nov 12; [Epub ahead of print]
1. Med Hypotheses. 2008 Nov 12; [Epub ahead of print]
Clinical trials validate the severity of persistent Lyme disease symptoms. Cameron DJ. First Medical Associates, 175 Main Street, Mt. Kisco, New York 10549, UnitedStates.
BACKGROUND: Persistent Lyme Disease Symptoms (PLDS) have included fatigue,headaches, poor concentration and memory, lightheadedness, joint pain, and mooddisturbances. Evidence-based guidelines committees disagree over the severity ofPLDS. The 2004 International Lyme and Associated Diseases Society (ILADS) concluded that PLDS are severe. The 2006 Infectious Disease Society of America(IDSA) guidelines committee concluded that PLDS are nothing more than the "achesand pains of daily living" and an ad hoc International Lyme group concluded thatPLDS are "symptoms common in persons who have never had Lyme disease."
HYPOTHESIS: Clinical trials validate the severity of persistent Lyme diseasesymptoms.
EVALUATION OF THE HYPOTHESIS: There are 22 standardized instrumentsused to measure the severity of PLDS among the four published NationalInstitutes of Health (NIH) sponsored double-blind randomized placebo-controlledtrials (RCTs).
VALIDATING THE HYPOTHESIS: All four NIH sponsored RCTs validatethe severity of PLDS. PLDS are as severe as symptoms seen in other seriouschronic illnesses, and result in a quality of life lower than for the generalpopulation as determined by 22 standardized measures of QOL, including fatigue,pain, role function, psychopathology, and cognition. None of the four RCTssupport the IDSA hypothesis that PLDS are nothing more than "the aches and painsof daily living" nor the ad hoc International Lyme group conclusion that PLDSare "symptoms common in persons who have never had Lyme disease."
IMPLICATIONS OF THE HYPOTHESIS: If the QOL of life for these patients is as poor as for patients with other serious chronic diseases, their symptoms need to beaddressed by their doctors. Studies differ as to the precise cause of PLDS, themost effective treatments, and whether a cure is possible. But the fact that there is disagreement is not a license for physicians to ignore or turn awaypatients complaining of PLDS, or to dismiss their symptoms as purelypsychosomatic. For physicians, the goal or purpose of treating PLDS should be the same as their purpose in treating other chronic illnesses that result in apoor QOL: vigorous pursuit of a cure, and where a cure proves impossible,amelioration of patients' symptoms and suffering. Even if this hypothesis failsto be apply to more than a fraction of the total Lyme disease population, thisstill represents a significant number of patients, and these findings couldaddress a neglected aspect of caring for patients with Lyme disease.
PMID: 19013025 [PubMed - as supplied by publisher]
Krooniset bakteerisairaudet
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale
"Bakteerisairaudet voivat kroonistua kuukausia/vuosia kestäviksi. Kroonistumisen syitä on useita esim. bakteerien kyky piiloutua immuunijärjestelmältä jne. Viime vuosikymmnenten aikana on puhuttu bakteerien muodostamista biofilmeistä. Elimistön oma immuunipuolustus ei kykene tunnistamaan niitä vihollisiksi. Tämän seurauksena infektio saattaa jatkua elimistössä pitkiä aikoja. Yksi esimerkki tällaisista biofilmi-infektioista on miesten eturauhastulehdus johon liittyy yleisesti myös virtsateiden infektio. Krooninen infektio on tyypillisesti E.colin aiheuttama.
Toinen tyypillinen esimerkki on Pseudomonas aeruginosan aiheuttama keuhkotulehdus erityisesti kystistä fibroosia sairastavilla. Infektiota on käytännössä lähes mahdoton parantaa sillä bakteerit ovat antibiooteille resistenttejä. Tuberkuloosi on niin ikään krooninen bakteeritulehdus keuhkoissa. Kuten muidenkin kroonisten sairauksien kohdalla, sen oireet voivat olla lievät. Ne joiden immuunijärjestelmä on heikko voivat saada vakavamman infektion. Myös borreliabakteeri voi aiheuttaa elimistössä kroonisen infektion.
Tutkimuksissa etsitään keinoja kroonisten bakteerisairauksien estämiseksi. Huomio on kohdistunut menetelmiin joilla voidaan estää bakteerin kiinnittyminen. Asiasta on saatu jo lupaavia tuloksia laboratorio-olosuhteissa." (suom.huom. esim. mannoosin teho perustuu juuri tähän mekanismiin. Mannoosia käytetään vaihtoehtoisena hoitomenetelmänä virtsateiden E.coli infektioissa)
Chronic Bacterial Disease
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale
Chronic bacterial infections persist for prolonged periods of time (e.g., months, years) in the host. This lengthy persistence is due to a number of factors including masking of the bacteria from the immune system, invasion of host cells, and the establishment of an infection that is resistance to antibacterial agents.
Over the past three decades, a number of chromic bacterial infections have been shown to be associated with the development of the adherent, exopolysaccharide-encased populations that are termed biofilms. The constituents of the exopolysaccharide are poorly immunogenic. This means that the immune system does not readily recognize the exopolysaccharide as foreign material that must be cleared from the body. Within the blanket of polysaccharide the bacteria, which would otherwise be swiftly detected by the immune system, are protected from immune recognition. As a result, the infection that is established can persist for a long time.
An example of a chronic, biofilm-related bacterial infection is prostatitis. Prostatitis is an inflammation of the prostate gland that is common in men over 30 years of age. Symptoms of this disease can include intense pain, urinary complications, and sexual malfunction including infertility. Chronic bacterial prostatitis is generally associated with repeated urinary tract infections. The chronic infection is typically caused by biofilms of Escherichia coli.
A second biofilm-related chronic bacterial infection is the Pseudomonas aeruginosa lung infection that develops early in life in some people who are afflicted with cystic fibrosis. Cystic fibrosis is due to a genetic defect that restricts the movement of salt and water in and out of cells in the lung. The resulting build-up of mucus predisposes the lungs to bacterial infection. The resulting Pseudomonas aeruginosa infection becomes virtually impossible to clear, due the antibiotic resistance of the bacteria within the biofilm. Furthermore, the body's response to the chronic infection includes inflammation. Over time, the inflammatory response is causes breathing difficulty that can be so pronounced as to be fatal.
Another chronic bacterial infection that affects the lungs is tuberculosis. This disease causes more deaths than any other infectious disease. Nearly two billion people are infected with the agent of tuberculosis, the bacterium Mycobacterium tuberculosis. As with other chronic infections, the symptoms can be mild. But, for those with a weakened immune system the disease can become more severe. Each year some three million people die of this active form of the tuberculosis infection.
Tuberculosis has re-emerged as a health problem in the United States, particularly among the poor. The development of drug resistance by the bacteria is a factor in this re-emergence.
Beginning in the mid 1970s, there has been an increasing recognition that maladies that were previously thought to be due to genetic or environmental factors in fact have their basis in chronic bacterial infections. A key discovery that prompted this shift in thinking concerning the origin of certain diseases was the demonstration by Barry Marshall that a bacterium called Helicobacter pylori is the major cause of stomach ulcers. Furthermore, there is now firm evidence of an association with chronic Helicobacter pylori stomach and intestinal infections and the development of certain types of intestinal cancers.
At about the same time the bacterium called Borrelia burgdorferi was established to be the cause of a debilitating disease known as Lyme disease. The spirochaete is able to establish a chronic infection in a host. The infection and the host's response to the infection, causes arthritis and long-lasting lethargy.
As a final recent example, Joseph Penninger has shown that the bacterium Chlamydia trachomatis is the agent that causes a common form of heart disease. The bacterium chronically infects a host and produces a protein that is very similar in three-dimensional structure to a protein that composed a heart valve. The host's immune response to the bacterial protein results in the deterioration of the heart protein, leading to heart damage.
Evidence is accumulating that implicates chronic bacterial infection with other human ailments including schizophrenia and Alzheimer's disease. While not yet conclusive, the involvement of chronic bacterial infections in maladies that have hitherto not been suspected of having a bacterial origin will not be surprising.
Research efforts to prevent chronic bacterial infections are focusing on the prevention of the surface adhesion that is a hallmark of many such infections. Molecules that can competitively block the sites to which the disease-causing bacteria bind have shown promising results in preventing infections in the laboratory setting.
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale, a part of the Thomson Corporation. All rights reserved.
http://mysite.verizon.net/felipe2/id12.html
Extremely Alkaline Forming Foods - pH 8.5 to 9.0
9.0 Lemons 1, Watermelon 2
8.5 Agar Agar 3, Cantaloupe, Cayenne (Capsicum) 4, Dried dates & figs, Kelp, Karengo, Kudzu root, Limes
Mango, Melons, Papaya, Parsley 5, Seedless grapes (sweet), Watercress, Seaweeds, Asparagus 6, Endive, Kiwifruit, Fruit juices 7, Grapes (sweet), Passion fruit, Pears (sweet), Pineapple, Raisins, Umeboshi plum, Vegetable juices 8
Moderate Alkaline - pH 7.5 to 8.0
8.0 Apples (sweet), Apricots, Alfalfa sprouts 9, Arrowroot, flour 10, Avocados, Bananas (ripe), Berries, Carrots, Celery, Currants, Dates & figs (fresh), Garlic 11, Gooseberry, Grapes (less sweet), Grapefruit, Guavas, Herbs (leafy green), Lettuce (leafy green), Nectarine, Peaches (sweet), Pears (less sweet), Peas (fresh sweet), Persimmon,
Pumpkin (sweet), Sea salt (vegetable) 12, Spinach
7.5 Apples (sour), Bamboo shoots, Beans (fresh green), Beets, Bell Pepper, Broccoli, Cabbage;Cauli, Carob
13, Daikon, Ginger (fresh), Grapes (sour), Kale, Kohlrabi, Lettuce (pale green), Oranges, Parsnip, Peaches (less sweet), Peas (less sweet), Potatoes & skin, Pumpkin (less sweet), Raspberry, Sapote, Strawberry, Squash 14, Sweet corn (fresh), Tamari 15, Turnip, Vinegar (apple cider) 16
Slightly Alkaline to Neutral pH 7.0
7.0 Almonds 17, Artichokes (Jerusalem), Barley-Malt (sweetener-Bronner), Brown Rice Syrup, Brussel Sprouts, Cherries, Coconut (fresh), Cucumbers, Egg plant, Honey (raw), Leeks, Miso, Mushrooms, Okra, Olives ripe 18, Onions, Pickles 19, (home made), Radish, Sea salt 20, Spices 21, Taro, Tomatoes (sweet), Vinegar (sweet brown rice), Water Chestnut Amaranth, Artichoke (globe), Chestnuts (dry roasted), Egg yolks (soft cooked), Essene bread 22, Goat's milk and whey (raw) 23, Horseradish, Mayonnaise (home made), Millet, Olive oil, Quinoa, Rhubarb, Sesame seeds (whole) 24, Soy beans (dry), Soy cheese, Soy milk, Sprouted grains 25, Tempeh, Tofu, Tomatoes (less sweet), Yeast (nutritional flakes)
Neutral pH 7.0 - Healthy Body Saliva pH Range is between 6.4 to 6.8 (on your pH test strips)
Butter (fresh unsalted), Cream (fresh & raw), Margarine 26, Milk (raw cow's) 27, Oils (except olive),
Whey (cow's), Yogurt (plain)
Med Hypotheses. 2008 Nov 12; [Epub ahead of print]
1. Med Hypotheses. 2008 Nov 12; [Epub ahead of print]
Clinical trials validate the severity of persistent Lyme disease symptoms. Cameron DJ. First Medical Associates, 175 Main Street, Mt. Kisco, New York 10549, UnitedStates.
BACKGROUND: Persistent Lyme Disease Symptoms (PLDS) have included fatigue,headaches, poor concentration and memory, lightheadedness, joint pain, and mooddisturbances. Evidence-based guidelines committees disagree over the severity ofPLDS. The 2004 International Lyme and Associated Diseases Society (ILADS) concluded that PLDS are severe. The 2006 Infectious Disease Society of America(IDSA) guidelines committee concluded that PLDS are nothing more than the "achesand pains of daily living" and an ad hoc International Lyme group concluded thatPLDS are "symptoms common in persons who have never had Lyme disease."
HYPOTHESIS: Clinical trials validate the severity of persistent Lyme diseasesymptoms.
EVALUATION OF THE HYPOTHESIS: There are 22 standardized instrumentsused to measure the severity of PLDS among the four published NationalInstitutes of Health (NIH) sponsored double-blind randomized placebo-controlledtrials (RCTs).
VALIDATING THE HYPOTHESIS: All four NIH sponsored RCTs validatethe severity of PLDS. PLDS are as severe as symptoms seen in other seriouschronic illnesses, and result in a quality of life lower than for the generalpopulation as determined by 22 standardized measures of QOL, including fatigue,pain, role function, psychopathology, and cognition. None of the four RCTssupport the IDSA hypothesis that PLDS are nothing more than "the aches and painsof daily living" nor the ad hoc International Lyme group conclusion that PLDSare "symptoms common in persons who have never had Lyme disease."
IMPLICATIONS OF THE HYPOTHESIS: If the QOL of life for these patients is as poor as for patients with other serious chronic diseases, their symptoms need to beaddressed by their doctors. Studies differ as to the precise cause of PLDS, themost effective treatments, and whether a cure is possible. But the fact that there is disagreement is not a license for physicians to ignore or turn awaypatients complaining of PLDS, or to dismiss their symptoms as purelypsychosomatic. For physicians, the goal or purpose of treating PLDS should be the same as their purpose in treating other chronic illnesses that result in apoor QOL: vigorous pursuit of a cure, and where a cure proves impossible,amelioration of patients' symptoms and suffering. Even if this hypothesis failsto be apply to more than a fraction of the total Lyme disease population, thisstill represents a significant number of patients, and these findings couldaddress a neglected aspect of caring for patients with Lyme disease.
PMID: 19013025 [PubMed - as supplied by publisher]
Krooniset bakteerisairaudet
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale
"Bakteerisairaudet voivat kroonistua kuukausia/vuosia kestäviksi. Kroonistumisen syitä on useita esim. bakteerien kyky piiloutua immuunijärjestelmältä jne. Viime vuosikymmnenten aikana on puhuttu bakteerien muodostamista biofilmeistä. Elimistön oma immuunipuolustus ei kykene tunnistamaan niitä vihollisiksi. Tämän seurauksena infektio saattaa jatkua elimistössä pitkiä aikoja. Yksi esimerkki tällaisista biofilmi-infektioista on miesten eturauhastulehdus johon liittyy yleisesti myös virtsateiden infektio. Krooninen infektio on tyypillisesti E.colin aiheuttama.
Toinen tyypillinen esimerkki on Pseudomonas aeruginosan aiheuttama keuhkotulehdus erityisesti kystistä fibroosia sairastavilla. Infektiota on käytännössä lähes mahdoton parantaa sillä bakteerit ovat antibiooteille resistenttejä. Tuberkuloosi on niin ikään krooninen bakteeritulehdus keuhkoissa. Kuten muidenkin kroonisten sairauksien kohdalla, sen oireet voivat olla lievät. Ne joiden immuunijärjestelmä on heikko voivat saada vakavamman infektion. Myös borreliabakteeri voi aiheuttaa elimistössä kroonisen infektion.
Tutkimuksissa etsitään keinoja kroonisten bakteerisairauksien estämiseksi. Huomio on kohdistunut menetelmiin joilla voidaan estää bakteerin kiinnittyminen. Asiasta on saatu jo lupaavia tuloksia laboratorio-olosuhteissa." (suom.huom. esim. mannoosin teho perustuu juuri tähän mekanismiin. Mannoosia käytetään vaihtoehtoisena hoitomenetelmänä virtsateiden E.coli infektioissa)
Chronic Bacterial Disease
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale
Chronic bacterial infections persist for prolonged periods of time (e.g., months, years) in the host. This lengthy persistence is due to a number of factors including masking of the bacteria from the immune system, invasion of host cells, and the establishment of an infection that is resistance to antibacterial agents.
Over the past three decades, a number of chromic bacterial infections have been shown to be associated with the development of the adherent, exopolysaccharide-encased populations that are termed biofilms. The constituents of the exopolysaccharide are poorly immunogenic. This means that the immune system does not readily recognize the exopolysaccharide as foreign material that must be cleared from the body. Within the blanket of polysaccharide the bacteria, which would otherwise be swiftly detected by the immune system, are protected from immune recognition. As a result, the infection that is established can persist for a long time.
An example of a chronic, biofilm-related bacterial infection is prostatitis. Prostatitis is an inflammation of the prostate gland that is common in men over 30 years of age. Symptoms of this disease can include intense pain, urinary complications, and sexual malfunction including infertility. Chronic bacterial prostatitis is generally associated with repeated urinary tract infections. The chronic infection is typically caused by biofilms of Escherichia coli.
A second biofilm-related chronic bacterial infection is the Pseudomonas aeruginosa lung infection that develops early in life in some people who are afflicted with cystic fibrosis. Cystic fibrosis is due to a genetic defect that restricts the movement of salt and water in and out of cells in the lung. The resulting build-up of mucus predisposes the lungs to bacterial infection. The resulting Pseudomonas aeruginosa infection becomes virtually impossible to clear, due the antibiotic resistance of the bacteria within the biofilm. Furthermore, the body's response to the chronic infection includes inflammation. Over time, the inflammatory response is causes breathing difficulty that can be so pronounced as to be fatal.
Another chronic bacterial infection that affects the lungs is tuberculosis. This disease causes more deaths than any other infectious disease. Nearly two billion people are infected with the agent of tuberculosis, the bacterium Mycobacterium tuberculosis. As with other chronic infections, the symptoms can be mild. But, for those with a weakened immune system the disease can become more severe. Each year some three million people die of this active form of the tuberculosis infection.
Tuberculosis has re-emerged as a health problem in the United States, particularly among the poor. The development of drug resistance by the bacteria is a factor in this re-emergence.
Beginning in the mid 1970s, there has been an increasing recognition that maladies that were previously thought to be due to genetic or environmental factors in fact have their basis in chronic bacterial infections. A key discovery that prompted this shift in thinking concerning the origin of certain diseases was the demonstration by Barry Marshall that a bacterium called Helicobacter pylori is the major cause of stomach ulcers. Furthermore, there is now firm evidence of an association with chronic Helicobacter pylori stomach and intestinal infections and the development of certain types of intestinal cancers.
At about the same time the bacterium called Borrelia burgdorferi was established to be the cause of a debilitating disease known as Lyme disease. The spirochaete is able to establish a chronic infection in a host. The infection and the host's response to the infection, causes arthritis and long-lasting lethargy.
As a final recent example, Joseph Penninger has shown that the bacterium Chlamydia trachomatis is the agent that causes a common form of heart disease. The bacterium chronically infects a host and produces a protein that is very similar in three-dimensional structure to a protein that composed a heart valve. The host's immune response to the bacterial protein results in the deterioration of the heart protein, leading to heart damage.
Evidence is accumulating that implicates chronic bacterial infection with other human ailments including schizophrenia and Alzheimer's disease. While not yet conclusive, the involvement of chronic bacterial infections in maladies that have hitherto not been suspected of having a bacterial origin will not be surprising.
Research efforts to prevent chronic bacterial infections are focusing on the prevention of the surface adhesion that is a hallmark of many such infections. Molecules that can competitively block the sites to which the disease-causing bacteria bind have shown promising results in preventing infections in the laboratory setting.
Chronic Bacterial Disease from World of Microbiology and Immunology.©2005-2006 Thomson Gale, a part of the Thomson Corporation. All rights reserved.
http://mysite.verizon.net/felipe2/id12.html
Extremely Alkaline Forming Foods - pH 8.5 to 9.0
9.0 Lemons 1, Watermelon 2
8.5 Agar Agar 3, Cantaloupe, Cayenne (Capsicum) 4, Dried dates & figs, Kelp, Karengo, Kudzu root, Limes
Mango, Melons, Papaya, Parsley 5, Seedless grapes (sweet), Watercress, Seaweeds, Asparagus 6, Endive, Kiwifruit, Fruit juices 7, Grapes (sweet), Passion fruit, Pears (sweet), Pineapple, Raisins, Umeboshi plum, Vegetable juices 8
Moderate Alkaline - pH 7.5 to 8.0
8.0 Apples (sweet), Apricots, Alfalfa sprouts 9, Arrowroot, flour 10, Avocados, Bananas (ripe), Berries, Carrots, Celery, Currants, Dates & figs (fresh), Garlic 11, Gooseberry, Grapes (less sweet), Grapefruit, Guavas, Herbs (leafy green), Lettuce (leafy green), Nectarine, Peaches (sweet), Pears (less sweet), Peas (fresh sweet), Persimmon,
Pumpkin (sweet), Sea salt (vegetable) 12, Spinach
7.5 Apples (sour), Bamboo shoots, Beans (fresh green), Beets, Bell Pepper, Broccoli, Cabbage;Cauli, Carob
13, Daikon, Ginger (fresh), Grapes (sour), Kale, Kohlrabi, Lettuce (pale green), Oranges, Parsnip, Peaches (less sweet), Peas (less sweet), Potatoes & skin, Pumpkin (less sweet), Raspberry, Sapote, Strawberry, Squash 14, Sweet corn (fresh), Tamari 15, Turnip, Vinegar (apple cider) 16
Slightly Alkaline to Neutral pH 7.0
7.0 Almonds 17, Artichokes (Jerusalem), Barley-Malt (sweetener-Bronner), Brown Rice Syrup, Brussel Sprouts, Cherries, Coconut (fresh), Cucumbers, Egg plant, Honey (raw), Leeks, Miso, Mushrooms, Okra, Olives ripe 18, Onions, Pickles 19, (home made), Radish, Sea salt 20, Spices 21, Taro, Tomatoes (sweet), Vinegar (sweet brown rice), Water Chestnut Amaranth, Artichoke (globe), Chestnuts (dry roasted), Egg yolks (soft cooked), Essene bread 22, Goat's milk and whey (raw) 23, Horseradish, Mayonnaise (home made), Millet, Olive oil, Quinoa, Rhubarb, Sesame seeds (whole) 24, Soy beans (dry), Soy cheese, Soy milk, Sprouted grains 25, Tempeh, Tofu, Tomatoes (less sweet), Yeast (nutritional flakes)
Neutral pH 7.0 - Healthy Body Saliva pH Range is between 6.4 to 6.8 (on your pH test strips)
Butter (fresh unsalted), Cream (fresh & raw), Margarine 26, Milk (raw cow's) 27, Oils (except olive),
Whey (cow's), Yogurt (plain)
Viimeksi muokannut soijuv, Pe Tammi 30, 2009 20:41. Yhteensä muokattu 2 kertaa.
Muutama tapausselostus joissa henkilöillä on neuroborrelioosi; yhdellä oireeton vaikka bakteereita löydettiin selkäydinnesteestä; yksi seronegatiivinen joka sai useita iv antibioottihoitoja ja viimeksi 22 kk klaritromysiiniä 5 vuoden aikana. Nyt hän on oireeton; yksi pysyi kunnossa jatkuvalla antibioottihoidolla mutta 2 viikkoa hoidon lopettamisesta hänellä alkoi huimaus uudelleen.
We report a case of latent neuroborreliosis that developed in a 17 year-old patient after multiple tick bites. B. burgdorferi was isolated from the spinal fluid, which was otherwise normal. EXHIBIT G ? Pfister, HW, Preac-Mursic, V, Wilske, B, et.al. Latent Lyme Neuroborreliosis: Presence of Borrelia burgdorferi in the cerebrospinal fluid without concurrent inflammatory without concurrent inflammatory signs. Neurology, 1989; 39:1118
Surprisingly, B. burgdorferi could be isolated from the CSF in the absence of any concurrent inflammatory changes. EXHIBIT G ? Pfister, HW, Preac-Mursic, V, Wilske, B, et.al. Latent Lyme Neuroborreliosis: Presence of Borrelia burgdorferi in the cerebrospinal fluid without concurrent inflammatory without concurrent inflammatory signs. Neurology, 1989; 39:1119
We describe a previously healthy woman with a 5 year history of a relapsing and remitting neurologic disorder involving the central nervous system and multiple peripheral and cranial nerves. We believe this to be an unusual case of seronegative Lyme disease, though she did not have a recognized tick bite or erythema migrans. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:115
Progressive neurologic symptoms and signs led to six courses of intravenous antibiotic therapy in the last 5 years. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
Each course of antibiotics produced a therapeutic response, with temporary arrest of neurologic progression. During two prolonged courses of antibiotics no new manifestations developed. The patient has now been on p.o. clarithromycin for 22 months, and no new symptoms or deficits have occurred during this time. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:115
Before her 6th hospital admission this patient had received four courses of ceftriaxone, one of cefotaxime and two of doxycycline (of 19 and 8 weeks). EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:116
Each course of therapy was associated with a Jarisch-Herxheimer-like reaction. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
Although the patient never had detectable free antibodies to B. burgdorferi in serum or spinal fluid, the CSF was positive on multiple occasions for complexed anti-B. burgdorferi antibodies, B. burgdorferi nucleic acids and free antigen. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
The following tests were performed by MetPath Laboratories: C1qBA, Raji assay, HTLV-1 antibody, IgG subclasses, and T lymphocyte profile. Routine laboratory tests were normal or negative, including Lyme antibodies. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
The patient?s right hemiparesis continued to improve and no new neurologic symptoms developed while on doxycycline. Within two weeks of stopping doxycycline the patient developed vertigo. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:114
We report a case of latent neuroborreliosis that developed in a 17 year-old patient after multiple tick bites. B. burgdorferi was isolated from the spinal fluid, which was otherwise normal. EXHIBIT G ? Pfister, HW, Preac-Mursic, V, Wilske, B, et.al. Latent Lyme Neuroborreliosis: Presence of Borrelia burgdorferi in the cerebrospinal fluid without concurrent inflammatory without concurrent inflammatory signs. Neurology, 1989; 39:1118
Surprisingly, B. burgdorferi could be isolated from the CSF in the absence of any concurrent inflammatory changes. EXHIBIT G ? Pfister, HW, Preac-Mursic, V, Wilske, B, et.al. Latent Lyme Neuroborreliosis: Presence of Borrelia burgdorferi in the cerebrospinal fluid without concurrent inflammatory without concurrent inflammatory signs. Neurology, 1989; 39:1119
We describe a previously healthy woman with a 5 year history of a relapsing and remitting neurologic disorder involving the central nervous system and multiple peripheral and cranial nerves. We believe this to be an unusual case of seronegative Lyme disease, though she did not have a recognized tick bite or erythema migrans. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:115
Progressive neurologic symptoms and signs led to six courses of intravenous antibiotic therapy in the last 5 years. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
Each course of antibiotics produced a therapeutic response, with temporary arrest of neurologic progression. During two prolonged courses of antibiotics no new manifestations developed. The patient has now been on p.o. clarithromycin for 22 months, and no new symptoms or deficits have occurred during this time. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:115
Before her 6th hospital admission this patient had received four courses of ceftriaxone, one of cefotaxime and two of doxycycline (of 19 and 8 weeks). EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:116
Each course of therapy was associated with a Jarisch-Herxheimer-like reaction. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
Although the patient never had detectable free antibodies to B. burgdorferi in serum or spinal fluid, the CSF was positive on multiple occasions for complexed anti-B. burgdorferi antibodies, B. burgdorferi nucleic acids and free antigen. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
The following tests were performed by MetPath Laboratories: C1qBA, Raji assay, HTLV-1 antibody, IgG subclasses, and T lymphocyte profile. Routine laboratory tests were normal or negative, including Lyme antibodies. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:113
The patient?s right hemiparesis continued to improve and no new neurologic symptoms developed while on doxycycline. Within two weeks of stopping doxycycline the patient developed vertigo. EXHIBIT H- Lawrence, C, Lipton, RB, Lowey, FD, Coyle, PK. Seronegative Chronic Relapsing Neuroborreliosis. European Neurology 1995:114
Munuaissiirron saaneelle henkilölle kehittyi borrelioosi ja anaplasmoosi (granulosytäärinen ehrlichioosi):
http://www.ncbi.nlm.nih.gov/entrez/quer ... &DB=pubmed
Transpl Infect Dis. 2007 Mar;9(1):66-72.
Lyme disease followed by human granulocytic anaplasmosis in a kidney transplant recipient.
* Assi MA,
* Yao JD,
* Walker RC.
Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic College of Medicine, Rochester, Minnesota, USA.
We report the case of a kidney transplant recipient who developed Lyme disease, followed by human granulocytic anaplasmosis (HGA) 3 years later. A review of all previously published cases of Lyme disease (3 cases), HGA (5 cases), and human monocytic ehrlichiosis (HME) (5 cases) in transplant recipients is presented. Manifestations of the cases reviewed were similar to those of non-transplant patients. There appeared to be no obvious correlation between immunosuppression and the occurrence of the illness in the transplant recipients. Serologic testing failed to make a diagnosis in 1 patient with HME in the literature and in our patient with HGA, but molecular tests established the diagnosis in both cases. Tandem infection was observed in 1 patient with two episodes of HME 2 years apart. A high index of suspicion for tick-borne illnesses and appropriate prevention measures are needed for transplant patients with epidemiologic risk factors.
PMID: 17313478 [PubMed - in process]
http://www.ncbi.nlm.nih.gov/entrez/quer ... &DB=pubmed
Transpl Infect Dis. 2007 Mar;9(1):66-72.
Lyme disease followed by human granulocytic anaplasmosis in a kidney transplant recipient.
* Assi MA,
* Yao JD,
* Walker RC.
Division of Infectious Diseases, Department of Internal Medicine, Mayo Clinic College of Medicine, Rochester, Minnesota, USA.
We report the case of a kidney transplant recipient who developed Lyme disease, followed by human granulocytic anaplasmosis (HGA) 3 years later. A review of all previously published cases of Lyme disease (3 cases), HGA (5 cases), and human monocytic ehrlichiosis (HME) (5 cases) in transplant recipients is presented. Manifestations of the cases reviewed were similar to those of non-transplant patients. There appeared to be no obvious correlation between immunosuppression and the occurrence of the illness in the transplant recipients. Serologic testing failed to make a diagnosis in 1 patient with HME in the literature and in our patient with HGA, but molecular tests established the diagnosis in both cases. Tandem infection was observed in 1 patient with two episodes of HME 2 years apart. A high index of suspicion for tick-borne illnesses and appropriate prevention measures are needed for transplant patients with epidemiologic risk factors.
PMID: 17313478 [PubMed - in process]
Eestiläinen tutkimus: Krooninen borrelioosi saattaa johtua poikkeavasta proinflammatoori vasteesta.
Borrelioosin kliininen kulku on erittäin vaihteleva. Tästä huolimatta kaikissa muodoissa ja vaiheissa on havaittavissa voimakas tulehdustila. Borreliabakteeri aiheuttaa useiden proinflammatooristen (tulehdusta edistävien) sytokiinien muodostumisen. Kroonisessa borrelioosissa esiintyi voimakkaampaa TNF-alfa vastetta verrattuna varhaisvaihetta sairastaviin tai terveisiin.
http://www.blackwell-synergy.com/doi/ab ... .apm_538.x
APMIS, Volume 115 Issue 2 Page 134-141 - February 2007
Propensity to excessive proinflammatory response in chronic Lyme borreliosis
KAI E. KISAND,1epartment of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
TIINA PRÃ?KK,2Department of Infectious Diseases, University of Tartu,
KALLE V. KISAND,1Department of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
SIIRI-MERIKE LÃ?Ã?S,3Neurology Clinic of Tartu University Hospital, Tartu, Estonia
IRJA KALBE3Neurology Clinic of Tartu University Hospital, Tartu, Estonia and
RAIVO UIBO1Department of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
Kai Kisand, Department of Immunology, Institute of General and Molecular Pathology, University of Tartu, Ravila Str. 19, Tartu 50411, Estonia. e-mail: Kai.Kisand@ut.ee
Kisand KE, Prükk T, Kisand KV, Lüüs SM, Kalbe I, Uibo R. Propensity to excessive proinflammatory response in chronic Lyme borreliosis. APMIS 2007;115:134â??41.
The clinical course of Lyme borreliosis is extremely variable. However, all the clinical manifestations, acute or chronic, are characterized by strong inflammation. Borrelia burgdorferi can induce the production of several proinflammatory and anti-inflammatory cytokines. The aim of our study was to find out whether the balance between inflammatory and regulatory mechanisms is important in determining the course of Lyme borreliosis. 13 patients with early Lyme borreliosis, 8 patients with chronic Lyme disease with neurological or joint manifestations, and 15 age- and sex-matched healthy controls were studied. Chronic forms of Lyme borreliosis were characterized by stronger TNF-α response by monocytes to lipopolysaccharide as well as to borrelia antigen compared to early Lyme borreliosis and the healthy state. The percentage of IL-10-secreting monocytes in response to borrelia lysate was lower in the Lyme borreliosis patients than in healthy controls. The percentage of CD4 + CTLA-4+ regulatory T cells showed the highest values in early Lyme borreliosis.
We conclude that chronic forms of Lyme borreliosis can evolve due to an aberrant innate proinflammatory response.
Borrelioosin kliininen kulku on erittäin vaihteleva. Tästä huolimatta kaikissa muodoissa ja vaiheissa on havaittavissa voimakas tulehdustila. Borreliabakteeri aiheuttaa useiden proinflammatooristen (tulehdusta edistävien) sytokiinien muodostumisen. Kroonisessa borrelioosissa esiintyi voimakkaampaa TNF-alfa vastetta verrattuna varhaisvaihetta sairastaviin tai terveisiin.
http://www.blackwell-synergy.com/doi/ab ... .apm_538.x
APMIS, Volume 115 Issue 2 Page 134-141 - February 2007
Propensity to excessive proinflammatory response in chronic Lyme borreliosis
KAI E. KISAND,1epartment of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
TIINA PRÃ?KK,2Department of Infectious Diseases, University of Tartu,
KALLE V. KISAND,1Department of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
SIIRI-MERIKE LÃ?Ã?S,3Neurology Clinic of Tartu University Hospital, Tartu, Estonia
IRJA KALBE3Neurology Clinic of Tartu University Hospital, Tartu, Estonia and
RAIVO UIBO1Department of Immunology, Institute of General and Molecular Pathology, Centre of Molecular and Clinical Medicine,
Kai Kisand, Department of Immunology, Institute of General and Molecular Pathology, University of Tartu, Ravila Str. 19, Tartu 50411, Estonia. e-mail: Kai.Kisand@ut.ee
Kisand KE, Prükk T, Kisand KV, Lüüs SM, Kalbe I, Uibo R. Propensity to excessive proinflammatory response in chronic Lyme borreliosis. APMIS 2007;115:134â??41.
The clinical course of Lyme borreliosis is extremely variable. However, all the clinical manifestations, acute or chronic, are characterized by strong inflammation. Borrelia burgdorferi can induce the production of several proinflammatory and anti-inflammatory cytokines. The aim of our study was to find out whether the balance between inflammatory and regulatory mechanisms is important in determining the course of Lyme borreliosis. 13 patients with early Lyme borreliosis, 8 patients with chronic Lyme disease with neurological or joint manifestations, and 15 age- and sex-matched healthy controls were studied. Chronic forms of Lyme borreliosis were characterized by stronger TNF-α response by monocytes to lipopolysaccharide as well as to borrelia antigen compared to early Lyme borreliosis and the healthy state. The percentage of IL-10-secreting monocytes in response to borrelia lysate was lower in the Lyme borreliosis patients than in healthy controls. The percentage of CD4 + CTLA-4+ regulatory T cells showed the highest values in early Lyme borreliosis.
We conclude that chronic forms of Lyme borreliosis can evolve due to an aberrant innate proinflammatory response.
Potilaalla ilmeni borreliabakteerin aiheuttama nopeasti etenevä dementia. Antibioottihoito auttoi selkeästi mutta kun se lopetettiin oireet palasivat ja potilas kuoli. Pidennetty antibioottihoito on todennäköisesti välttämätöntä.
Rapidly progressive frontal-type dementia associated with Lyme disease.
J Neuropsychiatry Clin Neurosci. 1995 Summer;7(3):345-7
Waniek C, Prohovnik I, Kaufman MA, Dwork AJ.
New York State Psychiatric Institute, NY 10032, USA.
The authors report a case of fatal neuropsychiatric Lyme disease (LD) that was expressed clinically by progressive frontal lobe dementia and pathologically by severe subcortical degeneration. Antibiotic treatment resulted in transient improvement, but the patient relapsed after the antibiotics were discontinued. LD must be considered even in cases with purely psychiatric presentation, and prolonged antibiotic therapy may be necessary.
PMID: 7580195 [PubMed - indexed for MEDLINE]
Rapidly progressive frontal-type dementia associated with Lyme disease.
J Neuropsychiatry Clin Neurosci. 1995 Summer;7(3):345-7
Waniek C, Prohovnik I, Kaufman MA, Dwork AJ.
New York State Psychiatric Institute, NY 10032, USA.
The authors report a case of fatal neuropsychiatric Lyme disease (LD) that was expressed clinically by progressive frontal lobe dementia and pathologically by severe subcortical degeneration. Antibiotic treatment resulted in transient improvement, but the patient relapsed after the antibiotics were discontinued. LD must be considered even in cases with purely psychiatric presentation, and prolonged antibiotic therapy may be necessary.
PMID: 7580195 [PubMed - indexed for MEDLINE]
Borreliabakteeri kykenee sekä yliaktivoimaan että heikentämään elimistön puolustusjärjestelmää. Se saattaa selittää sekä akuutissa että kroonisessa borrelioosissa esintyvät oireet.
Spirokeettojen kyky selviytyä elimistössä on todettu sekä kupan aiheuttajan että borreliabakteerin kohdalla. Siihen on tri C. Pavian mukaan useita eri syitä esim. antigeenin muuntelu, epätyypilliset muodot esim. kystatyyppiset muodot, elimistön riittämätön kyky muodostaa vasta-aineita; T-soluja tai fagosyyttejä, häiriintynyt immuunivaste (syynä esim. elimistö, punkki, spirokeetta), muita syitä kuten spirokeetan liikkuvuus jne.
Koko artikkeli: http://www.medscape.com/viewarticle/418448
Fighting Back: How B burgdorferi Persists CME
Disclosures
Harry Goldhagen, MS Julie Rawlings, MPH
Persistence Is a Virtue
That spirochetes tend to persist in the human body has been demonstrated in both syphilis, caused by Treponema pallidum, and Lyme disease, caused by Borrelia burgdorferi. What accounts for this ability to evade or suppress an effective immune response? According to Charles Pavia, PhD,[1] of the New York College of Osteopathic Medicine, New York Institute of Technology, Old Westbury, New York, there are at least 6 potential explanations:
antigenic variation (this is seen with the Borrelia species that cause tick-borne relapsing fever) or differential expression of antigens (especially the outer surface proteins; with B burgdorferi, only OspC is expressed during mammalian infection)
production of an outer protective coat (eg, capsule, as seen with T pallidum)
atypical forms (eg, cyst-like variants)
incomplete immune response (eg, insufficient antibody , T-cell , or phagocytic response)
deranged host immune response (eg, host-, tick-, or spirochete-derived immunosuppressive factors)
other evasive factors (eg, motility)
Immune Suppression
Is there evidence that any of these mechanisms allow B burgdorferi to persist in the human body? As of now, not much. However, there have been a few suggestive studies in animals that support immune suppression as a possible explanation. For instance, a study by Chiao and colleagues[2] showed that B burgdorferi is capable of suppressing the immune response. When sonicated Borrelia were added to lymphocytes, the ability of the lymphocytes to proliferate -- a measure of the immune system's ability to respond to an infectious challenge -- was inhibited.
A similar study by Giambartolomei and coworkers[3] showed that Borrelia can stimulate interleukin-10 (IL-10) production, a downregulator of the immune system. In this series of experiments, heat-killed B burgdorferi caused peripheral blood mononuclear cells of humans and rhesus monkeys to produce this cytokine. Another study, by Keane-Myers and Nickell,[4] found that B burgdorferi could suppress T-cell responses in mice, specifically T-helper cells.
Even the tick itself may play a role in immunosuppression. Urioste and colleagues[5] showed that the saliva of Ixodes dammini ticks contains an uncharacterized substance that can suppress the immune response, specifically suppressing lymphocyte proliferation and other markers of immune system activity.
Looking at the issue of immune suppression from the other side -- that is, by boosting the immune response with the use of cytokines -- Zeidner and colleagues[6] showed that tumor necrosis factor alpha (TNF-alpha), IL-2, and interferon-gamma could suppress B burgdorferi infection in mice.
By contrast, it appears that infection with B burgdorferi can also overstimulate the immune system, and this may explain many of the symptoms of both acute and chronic Lyme disease. For instance, Lim and colleagues[7] showed that CD4+ T cells play a role in the arthritis seen in the hamster model of Lyme disease.
Remainder of the article at: http://www.medscape.com/viewarticle/418448
Spirokeettojen kyky selviytyä elimistössä on todettu sekä kupan aiheuttajan että borreliabakteerin kohdalla. Siihen on tri C. Pavian mukaan useita eri syitä esim. antigeenin muuntelu, epätyypilliset muodot esim. kystatyyppiset muodot, elimistön riittämätön kyky muodostaa vasta-aineita; T-soluja tai fagosyyttejä, häiriintynyt immuunivaste (syynä esim. elimistö, punkki, spirokeetta), muita syitä kuten spirokeetan liikkuvuus jne.
Koko artikkeli: http://www.medscape.com/viewarticle/418448
Fighting Back: How B burgdorferi Persists CME
Disclosures
Harry Goldhagen, MS Julie Rawlings, MPH
Persistence Is a Virtue
That spirochetes tend to persist in the human body has been demonstrated in both syphilis, caused by Treponema pallidum, and Lyme disease, caused by Borrelia burgdorferi. What accounts for this ability to evade or suppress an effective immune response? According to Charles Pavia, PhD,[1] of the New York College of Osteopathic Medicine, New York Institute of Technology, Old Westbury, New York, there are at least 6 potential explanations:
antigenic variation (this is seen with the Borrelia species that cause tick-borne relapsing fever) or differential expression of antigens (especially the outer surface proteins; with B burgdorferi, only OspC is expressed during mammalian infection)
production of an outer protective coat (eg, capsule, as seen with T pallidum)
atypical forms (eg, cyst-like variants)
incomplete immune response (eg, insufficient antibody , T-cell , or phagocytic response)
deranged host immune response (eg, host-, tick-, or spirochete-derived immunosuppressive factors)
other evasive factors (eg, motility)
Immune Suppression
Is there evidence that any of these mechanisms allow B burgdorferi to persist in the human body? As of now, not much. However, there have been a few suggestive studies in animals that support immune suppression as a possible explanation. For instance, a study by Chiao and colleagues[2] showed that B burgdorferi is capable of suppressing the immune response. When sonicated Borrelia were added to lymphocytes, the ability of the lymphocytes to proliferate -- a measure of the immune system's ability to respond to an infectious challenge -- was inhibited.
A similar study by Giambartolomei and coworkers[3] showed that Borrelia can stimulate interleukin-10 (IL-10) production, a downregulator of the immune system. In this series of experiments, heat-killed B burgdorferi caused peripheral blood mononuclear cells of humans and rhesus monkeys to produce this cytokine. Another study, by Keane-Myers and Nickell,[4] found that B burgdorferi could suppress T-cell responses in mice, specifically T-helper cells.
Even the tick itself may play a role in immunosuppression. Urioste and colleagues[5] showed that the saliva of Ixodes dammini ticks contains an uncharacterized substance that can suppress the immune response, specifically suppressing lymphocyte proliferation and other markers of immune system activity.
Looking at the issue of immune suppression from the other side -- that is, by boosting the immune response with the use of cytokines -- Zeidner and colleagues[6] showed that tumor necrosis factor alpha (TNF-alpha), IL-2, and interferon-gamma could suppress B burgdorferi infection in mice.
By contrast, it appears that infection with B burgdorferi can also overstimulate the immune system, and this may explain many of the symptoms of both acute and chronic Lyme disease. For instance, Lim and colleagues[7] showed that CD4+ T cells play a role in the arthritis seen in the hamster model of Lyme disease.
Remainder of the article at: http://www.medscape.com/viewarticle/418448
Kroonista borrelioosia sairastavilla esiintyy ongelmia tulehdusvälittäjäaine TGF-beta 1:n synteesissä. Vajaus aiheuttaa lisääntynyttä tulehdusalttiutta ja poikkeavaa immuunivastetta.
Adv Med Sci. 2007;52:174-8. Concentration of TGF-beta1 in the supernatant of peripheral blood mononuclear cells cultures from patients with early disseminated and chronic lyme borreliosis. Grygorczuk S, Chmielewski T, Zajkowska J, Swierzbinska R, Pancewicz S, Kondrusik M, Tylewska-Wierzbanowska S, Hermanowska-Szpakowicz T. Department of Infectious Diseases and Neuroinfections, Medical University of Bialystok, ul. Zurawia 14, 15-540 Bialystok, Poland. neuroin@amb.edu.pl
PURPOSE: The aberrant inflammatory response is probably involved in thepathogenesis of chronic Lyme borreliosis, including chronic Lyme arthritis and neuroborreliosis. Transforming growth factor-beta 1 (TGF-beta1) is an important anti-inflammatory and immunomodulatory cytokine and its deficient synthesis is linked to exaggerated inflammation and immune response.
MATERIAL AND METHODS:Peripheral blood mononuclear cells (PBMC) from 25 patients with Lyme borreliosis and 6 controls were incubated for 7 days with suspension of Borrelia afzeli, B. garinii and B. burgdorferi sensu stricto spirochetes. TGF-beta1 concentration in culture supernatants was measured with ELISA. Results were analyzed according to disease duration (group I--chronic borreliosis, n=20; group II--early borreliosis, n=5) and clinical form (LA--arthritis, NB--neuroborreliosis).
RESULTS: TGF-beta1 concentration was increased in supernatants of PBMC cultures of patients with early neuroborreliosis, in comparison with chronic borreliosis and controls. In chronic, but not in early borreliosis, there was a tendency for decrease of TGF-beta1 synthesis under stimulation with B. burgdorferi spirochetes. CONCLUSIONS: Impaired synthesis of TGF-beta1 by mononuclear cellsseems to be present in patients with chronic forms of Lyme borreliosis when compared to those with early stage of the disease. It may be a factorcontributing to the persistence of inadequate inflammatory response in patients in whom chronic form of the disease develops.
Publication Types:Research Support, Non-U.S. Gov't PMID: 18217413 [PubMed - in process]
Adv Med Sci. 2007;52:174-8. Concentration of TGF-beta1 in the supernatant of peripheral blood mononuclear cells cultures from patients with early disseminated and chronic lyme borreliosis. Grygorczuk S, Chmielewski T, Zajkowska J, Swierzbinska R, Pancewicz S, Kondrusik M, Tylewska-Wierzbanowska S, Hermanowska-Szpakowicz T. Department of Infectious Diseases and Neuroinfections, Medical University of Bialystok, ul. Zurawia 14, 15-540 Bialystok, Poland. neuroin@amb.edu.pl
PURPOSE: The aberrant inflammatory response is probably involved in thepathogenesis of chronic Lyme borreliosis, including chronic Lyme arthritis and neuroborreliosis. Transforming growth factor-beta 1 (TGF-beta1) is an important anti-inflammatory and immunomodulatory cytokine and its deficient synthesis is linked to exaggerated inflammation and immune response.
MATERIAL AND METHODS:Peripheral blood mononuclear cells (PBMC) from 25 patients with Lyme borreliosis and 6 controls were incubated for 7 days with suspension of Borrelia afzeli, B. garinii and B. burgdorferi sensu stricto spirochetes. TGF-beta1 concentration in culture supernatants was measured with ELISA. Results were analyzed according to disease duration (group I--chronic borreliosis, n=20; group II--early borreliosis, n=5) and clinical form (LA--arthritis, NB--neuroborreliosis).
RESULTS: TGF-beta1 concentration was increased in supernatants of PBMC cultures of patients with early neuroborreliosis, in comparison with chronic borreliosis and controls. In chronic, but not in early borreliosis, there was a tendency for decrease of TGF-beta1 synthesis under stimulation with B. burgdorferi spirochetes. CONCLUSIONS: Impaired synthesis of TGF-beta1 by mononuclear cellsseems to be present in patients with chronic forms of Lyme borreliosis when compared to those with early stage of the disease. It may be a factorcontributing to the persistence of inadequate inflammatory response in patients in whom chronic form of the disease develops.
Publication Types:Research Support, Non-U.S. Gov't PMID: 18217413 [PubMed - in process]
Italialainen tutkimus. Henkilö on sairastanut borrelioosia 2 v. Hän oli saanut hoidoksi 4 viikon doksisykliinikuurin. Nyt hänelle kehittyi borreliabakteerin aiheuttama silmän makulan turvotus. Suonensisäinen keftriaksoni (Rocephalin) yms. olivat tehottomia. Silmäruiskeena annettu triamkinoloni tehosi n. kuukaudessa.
Graefes Arch Clin Exp Ophthalmol. 2008 Jan 12; [Epub ahead of print]
Intravitreal triamcinolone for macular edema in Lyme disease.
Reibaldi M, Faro S, Motta L, Longo A.
Eye Clinic, University of Catania, via Santa Sofia 78, Catania, Italy,
ant-longo@libero.it.
BACKGROUND:
To describe the outcome in a patient with macular edema caused by Lyme disease treated with injection of 4 mg intravitreal triamcinolone.
METHODS:
The patient, 2 years after systemic Lyme disease treated with doxycycline for 4 weeks, developed macular edema with serous retinal detachment in one eye (visual acuity: 0.6). After unsuccessful therapy with intravenous ceftriaxone, indomethacin and acetazolamide, 4 mg intravitreal triamcinolone (IVTA) was injected via the pars plana.
RESULTS: Visual acuity improved to 1.0 and macular thickness recovered over 1 month. No changes were found in intraocular pressure. No recurrence of macular edema was seen after 2 years.
CONCLUSIONS: IV TA can restore visual acuity and reduce macular thickness in macular edema caused by Lyme disease. However, since borreliosis is a systemic disease, previous systemic antibiotic treatment is recommended.
PMID: 18193264 [PubMed - as supplied by publisher]
Graefes Arch Clin Exp Ophthalmol. 2008 Jan 12; [Epub ahead of print]
Intravitreal triamcinolone for macular edema in Lyme disease.
Reibaldi M, Faro S, Motta L, Longo A.
Eye Clinic, University of Catania, via Santa Sofia 78, Catania, Italy,
ant-longo@libero.it.
BACKGROUND:
To describe the outcome in a patient with macular edema caused by Lyme disease treated with injection of 4 mg intravitreal triamcinolone.
METHODS:
The patient, 2 years after systemic Lyme disease treated with doxycycline for 4 weeks, developed macular edema with serous retinal detachment in one eye (visual acuity: 0.6). After unsuccessful therapy with intravenous ceftriaxone, indomethacin and acetazolamide, 4 mg intravitreal triamcinolone (IVTA) was injected via the pars plana.
RESULTS: Visual acuity improved to 1.0 and macular thickness recovered over 1 month. No changes were found in intraocular pressure. No recurrence of macular edema was seen after 2 years.
CONCLUSIONS: IV TA can restore visual acuity and reduce macular thickness in macular edema caused by Lyme disease. However, since borreliosis is a systemic disease, previous systemic antibiotic treatment is recommended.
PMID: 18193264 [PubMed - as supplied by publisher]
"Borrelioosi ilmenee eri henkilöillä eri tavoin. Joillakin bakteeri on kroonisena ilman että se aiheuttaa oireita, joillakin se aiheuttaa lieviä oireita silloin tällöin ja toisilla se aiheuttaa vakavia häiriöitä eri puolilla elimistöä. Borrelioositestit eivät ole riittävän luotettavia ne eivät ole esim. riittävän herkkiä tunnistmaan bakteeria ja siksi vääriä negatiivisia testituloksia esiintyy usein. Borrelioosi saatetaan diagnosoida virheellisesti esim. fibromyalgiaksi, krooniseksi väsymysoireyhtymäksi, MS-taudiksi jne.
Psykiatriassa keskitytään yleensä hoitamaan oireita eikä oireiden taustalla olevia syitä. Siksi tulisi olla suurempi ymmärrys immuunijärjestelmän tavasta reagoida infektioihin ja muihin vastaaviin seikkoihin jotka vaikuttavat olennaisesti psyykkisiin oireisiin.
Oireiden hoitaminen kortisonilla saattaa tuoda helpotusta lyhyeksi aikaa mutta sitä seuraa yleensä nopea oireiden paheneminen. Potilas tapaa useita omaan erikoisalueeseensa erikoistuneita lääkäreitä ja jokainen näkee potilaan ongelman ainoastaan omista lähtökohdistaan. Potilaan ongelmien kokonaistilanne ei selviä ja potilas turhautuu moninaisten oireidensa kanssa. Potilaalle annetaan usein erilaisia psyykelääkkeitä jotka saattavat auttaa jonkin verran mutta tilanne huononee kuitenkin tasaisesti."
Artikkeli kokonaisuudessaan: http://www.psychiatrictimes.com/showArt ... =204701791
The major complaints include fatigue, multiple cognitive "
joulukuu 01, 2007 Vol. 24 No. 14
Lyme Disease, Comorbid Tick-Borne Diseases, and Neuropsychiatric Disorders
Robert C. Bransfield, MD
Page 1 of 2
--------------------------------------------------------------------------------
Dr Bransfield is associate director of psychiatry at Riverview Medical Center in Red Bank, NJ. Psychiatrists interested in joining the Microbes and Mental Illness Discussion Group may e-mail the author at bransfield@comcast.net. He is President Elect of the International Lyme and Associated Diseases Society. The author reports that he is on the Speakers' Bureau of Abbott, AstraZeneca, Cephalon, Forest, GlaxoSmithKline, Jazz, Lilly, Pfizer, Sanofi Aventis, Takeda, UCB, and Wyeth; and he is on the advisory board for the Lyme Disease Association, Turn the Corner Foundation, Morgellons Research Foundation, and Lyme Induced Foundation.
--------------------------------------------------------------------------------
Many recall the phrase "To know syphilis is to know medicine." Now Lyme disease (Lyme borreliosis), the new "great imitator,"1 is the ultimate challenge to the breadth and depth of our knowledge. In psychiatry, we generally treat mental symptoms or syndromes rather than the underlying cause of a disorder. A greater awareness of immune reactions to infections and other contributors to mental illness enhances our psychiatric capabilities. Lyme disease, like syphilis, is caused by a spirochete with a multitude of pos-sible manifestations and 3 stages: early with dermatological symptoms, disseminated, and late stage.
Unlike Treponema pallidum, the cause of syphilis, the causative agent of Lyme disease, Borrelia burgdorferi, can be much more difficult to eliminate, diagnostic testing is less reliable, and interactive copathogens are major contributors in the pathophysiology.2,3 B burgdorferi is highly adaptable with 6 times as many genes as T pallidum and 3 times as many plasmids as any other bacteria that allow rapid genetic adaptations.4,5 It is a stealth pathogen that can evade the immune system and pathophysiological mechanisms.6,7 Knowingly or not, most psychiatrists have at some point been perplexed by patients with late-stage psychiatric manifestations of Lyme borreliosis. Several factors are associated with the risk of infection as well as the different manifestations of Lyme borreliosis (Table 1).
A problematic case
The following composite case illustrates a number of problems that may make diagnosis and treatment of Lyme borreliosis anything but straightforward. The patient is in good health and enjoys outdoor activities. Often this person has the HLA DR4 genotype. He or she may acquire a small tick bite that goes unnoticed because the subsequent rash may not be of the classic bull's-eye type, may be easily overlooked in dark-skinned individuals, may be misdiagnosed, or may occur only with a second or subsequent infection. There may be flu-like symptoms with migratory musculoskeletal aches and pains. If a diagnosis of Lyme disease is made, the initial course of antibiotic treatment may not have been sufficient to eliminate the infection. (Although standardized by 1 set of guidelines, psychiatrists often see the failures of some of the "standard" treatments.) Low-grade symptoms may remit and periodically relapse over time. An accident, emotional stress, vaccination, or childbirth can trigger an exacerbation of symptoms.
The patient, who did not have psychosomatic symptoms and was not hypochondriacal in the past, now complains of an increasing number of somatic, cognitive, neurological, and psychiatric symptoms. Although Lyme disease may be suspected, the laboratory tests available to most clinicians often lack sensitivity and thus are read as negative for Lyme disease. Fibromyalgia, chronic fatigue syndrome, or multiple sclerosis (MS) may be erroneously diagnosed.
Treatment of some symptoms with corticosteroids may initially provide relief, but a more rapid decline often follows. The patient sees multiple specialists, each of whom restricts the examination to his area of expertise. Nothing is resolved, and the patient is frustrated that his symptoms cannot be explained. In view of the growing list of unexplained symptoms, including psychiatric symptoms, the patient is treated with tranquilizers and antidepressants with some benefit, but gradual decline persists. impairments, depression, anxiety, irritability, head-aches, and a multitude of other symptoms. When general medical treatment fails, the patient may be referred to a psychiatrist for 3 reasons: the unexplained medical symptoms give the appearance of a psychosomatic or somatoform condition; complex mental symptoms are thought to require psychiatric assessment; and a psychiatrist is thought to be needed to more effectively manage psychiatric treatments.
The Figure presents single photon emission CT (SPECT) images of the brain of a depressed 51-year-old woman with Lyme disease, before and after treatment with ceftriaxone. She walked on nature trails at home and on vacations, recalled frequent tick bites and an expanding bull's-eye rash on her abdomen with no other symptoms, but considered it of no special significance at the time. Over 8 years, there was a progressive development of unexplained symptoms that began with GI complaints, followed by cognitive impairment, fatigue, depression, arthritis, and shortness of breath. The primary diagnosis was atypical depression. Although the patient failed to respond to 51 different drug trials, the treating psychopharmacologist assured her the mental symptoms could not possibly be caused by an underlying physical condition.
The initial SPECT scan demonstrated "extensive hypoperfusion... predominantly in the frontal and temporal lobes and to a less degree in the parietal and occipital lobes," which is consistent with Lyme disease and neurodysfunction. Neurocognitive testing demonstrated significant abnormalities. An MRI scan ruled out frontal temporal dementia. The patient tested negative for Lyme disease by CDC epidemiological criteria, but the Lyme IgG Western blot test result was positive at one laboratory and equivocal at another. The CD57 lymphocyte count was low at 17/µL (60 to 360) and the patient tested positive for 4 other tick-borne infections (Mycoplasma fermentans, Babesia microti, Babesia WA-1, and Bartonella henselae). The patient was intolerant to oral antibiotics and was treated with 8 months of intravenous ceftriaxone. The second SPECT scan demonstrated "marked improvement of the hypoperfusion pattern in the temporal, frontal, and parietal lobes and small areas of hypoperfusion pattern remain." The depression never returned, but some mild residual symptoms persist, including fatigue, neuropathy, and arthritis; however, she has mostly returned to her active lifestyle. The failure to diagnose and treat these infections for several years resulted in an escalation of symptoms and a loss 8 years of her life that could have been prevented by earlier diagnosis and treatment.
General theoretical issues
The causes of most psychiatric illnesses are unknown. The catecholamine hypothesis does not adequately explain the cause of abnormal neurotransmitter functioning. Mendel stated that human traits are determined by individual genes that function independently of other genes and environmental influences. Koch believed that many human diseases are caused by microbes that exert their effect independently of other microbes, environmental factors, and genes. The cause of most mental illnesses cannot be explained by neurotransmitters, genes, or infections alone. Instead, as stated by Yolken,8
most common human diseases are caused by the interaction of environmental insults and susceptibility genes.Many of the susceptibility genes are diverse determinants of human response to environmental factors, including infections, and prevention or treatment of the infections may result in the effective treatment of complex disorders.
Neuropsychiatric disease is often associated with an interaction of environmental insults and susceptibility factors that frequently results in a pathological interaction including inflammation, oxidative stress, mitochondrial dysfunction, and excitotoxicity, which leads to neuronal dysfunction.3
Numerous studies document that infections, such as pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections, syphilis, hepatitis C, and zoonotic (animal) diseases, can cause mental illness.9-13 The same syndrome may be caused by different infections in different individuals, and the same infection can cause different syndromes in different individuals. For example, obsessive-compulsive disorder has been caused by infection with Streptococcus, B burgdorferi, Japanese B encephalitis virus, herpes simplex virus 1, Borna disease virus, Epstein-Barr virus, and Mycoplasma, as well as by thepandemic influenza of 191814-16; I have also observed cases caused by Hong Kong influenza and coxsackievirus infection. Of course, many of these infections have also been shown to cause other psychiatric and somatic symptoms. Some infections result in residual injury even after the infection itself no longer persists, while other infections may persist in a chronic relapsing and remitting state. Chronic infections are most commonly viral, venereal, and vector-borne zoonotic.8
Tick-borne diseases and chronic infectious diseases
B burgdorferi, the principal organism associated with Lyme borreliosis, is one of the most complex bacteria known to man. In addition, a tick bite can presumably transmit more than 1 disease-causing organism. Thus, 2 major clinical hurdles in diagnosis and management are the absence of a clear therapeutic end point in treating Lyme borreliosis and the potential presence of tick-borne coinfections that may complicate the course of the illness.3 The more common interactive coinfections may be caused by M fermentans, Mycoplasma pneumoniae, B microti, Ba- besia WA-1, Chlamydia pneumoniae, Ehrlichia, Anaplasma, and B henselae, and multiple viruses and fungi.2,3,17 When multiple microbes grow together, they can promote immunosuppressive effects and cause marked symbiotic changes that alter their functioning.18
Neuroborreliosis is an infection within the brain; however, infections in the body that do not pass through the blood-brain barrier may also impact the brain indirectly via immune effects. All the clinical manifestations, acute or chronic, of infection with B burgdorferi are characterized by strong inflammation with the production of several proinflammatory and anti-inflammatory cytokineswith an aberrant innate proinflammatory response19 and inflammatory brain changes.20 Most of the dysfunction caused by these infections is associated with immune reactions.
Lyme borreliosis and other tick-borne infections are associated with a combination of inflammatory reactions and autoimmune symptoms. The proinflammatory cytokines associated with these infections increase indoleamine 2,3-dioxygenase, which decreases serotonin and kynurenic acid, a neuroprotective glutamate antagonist. In addition, the cytokines increase the level ofquinolinic acid, an N-methyl d-aspartic acid (NMDA) agonist and neurotoxin, which contributes to the neurological and cognitive deficits seen in patients with tick-borne infections.21-23 This change may produce over-stimulation of hippocampal (NMDA) receptors leading to apoptosis and hippocampal atrophy. Hippocampal atrophy in the temporal lobes caused by NMDA overstimulation has been associated with depression and dementia.24
Lyme borreliosis and other tick-borne infections can exist as an asymptomatic chronic carrier state, they can present with occasional or chronic fluctuating low-level symptoms, or they can lead to severe multisystem dysfunction and a multitude of psychiatric presentations.2
Assessment
Some helpful screening questions for a person with suspected late or complicated B burgdorferi infection are listed in Table 2. Positive responses require a thorough history, review of systems, and assessment of cognitive, emotional, vegetative, behavioral, psychiatric, neurological, and somatic symptoms.
TABLE 2
Screening for suspected late or complicated Lyme disease
1. Do you live or have you vacationed in areas that may expose you to ticks?
2. Have you engaged in activities that may have exposed you to ticks? expectations
3. Have family members, neighbors, or the family dog been infected?
4. Is there a history of a tick bite, possibly with a flu-like illness and/or a bull's-eye or other rash?
5. Is there a point at which the patients health declined, followed by a relapsing progression and development of multisystemic symptoms, including cognitive, psychiatric, neurological, and physical symptoms?
6. Have antibiotics ever caused a sudden worsening followed by an improvement of symptoms?*
*Refer to Jarisch-Herxheimer reaction in Discussion section.
-----------------------------------------------------------------------------
Page 2: Lyme borreliosis
Page 1 | 2
Psykiatriassa keskitytään yleensä hoitamaan oireita eikä oireiden taustalla olevia syitä. Siksi tulisi olla suurempi ymmärrys immuunijärjestelmän tavasta reagoida infektioihin ja muihin vastaaviin seikkoihin jotka vaikuttavat olennaisesti psyykkisiin oireisiin.
Oireiden hoitaminen kortisonilla saattaa tuoda helpotusta lyhyeksi aikaa mutta sitä seuraa yleensä nopea oireiden paheneminen. Potilas tapaa useita omaan erikoisalueeseensa erikoistuneita lääkäreitä ja jokainen näkee potilaan ongelman ainoastaan omista lähtökohdistaan. Potilaan ongelmien kokonaistilanne ei selviä ja potilas turhautuu moninaisten oireidensa kanssa. Potilaalle annetaan usein erilaisia psyykelääkkeitä jotka saattavat auttaa jonkin verran mutta tilanne huononee kuitenkin tasaisesti."
Artikkeli kokonaisuudessaan: http://www.psychiatrictimes.com/showArt ... =204701791
The major complaints include fatigue, multiple cognitive "
joulukuu 01, 2007 Vol. 24 No. 14
Lyme Disease, Comorbid Tick-Borne Diseases, and Neuropsychiatric Disorders
Robert C. Bransfield, MD
Page 1 of 2
--------------------------------------------------------------------------------
Dr Bransfield is associate director of psychiatry at Riverview Medical Center in Red Bank, NJ. Psychiatrists interested in joining the Microbes and Mental Illness Discussion Group may e-mail the author at bransfield@comcast.net. He is President Elect of the International Lyme and Associated Diseases Society. The author reports that he is on the Speakers' Bureau of Abbott, AstraZeneca, Cephalon, Forest, GlaxoSmithKline, Jazz, Lilly, Pfizer, Sanofi Aventis, Takeda, UCB, and Wyeth; and he is on the advisory board for the Lyme Disease Association, Turn the Corner Foundation, Morgellons Research Foundation, and Lyme Induced Foundation.
--------------------------------------------------------------------------------
Many recall the phrase "To know syphilis is to know medicine." Now Lyme disease (Lyme borreliosis), the new "great imitator,"1 is the ultimate challenge to the breadth and depth of our knowledge. In psychiatry, we generally treat mental symptoms or syndromes rather than the underlying cause of a disorder. A greater awareness of immune reactions to infections and other contributors to mental illness enhances our psychiatric capabilities. Lyme disease, like syphilis, is caused by a spirochete with a multitude of pos-sible manifestations and 3 stages: early with dermatological symptoms, disseminated, and late stage.
Unlike Treponema pallidum, the cause of syphilis, the causative agent of Lyme disease, Borrelia burgdorferi, can be much more difficult to eliminate, diagnostic testing is less reliable, and interactive copathogens are major contributors in the pathophysiology.2,3 B burgdorferi is highly adaptable with 6 times as many genes as T pallidum and 3 times as many plasmids as any other bacteria that allow rapid genetic adaptations.4,5 It is a stealth pathogen that can evade the immune system and pathophysiological mechanisms.6,7 Knowingly or not, most psychiatrists have at some point been perplexed by patients with late-stage psychiatric manifestations of Lyme borreliosis. Several factors are associated with the risk of infection as well as the different manifestations of Lyme borreliosis (Table 1).
A problematic case
The following composite case illustrates a number of problems that may make diagnosis and treatment of Lyme borreliosis anything but straightforward. The patient is in good health and enjoys outdoor activities. Often this person has the HLA DR4 genotype. He or she may acquire a small tick bite that goes unnoticed because the subsequent rash may not be of the classic bull's-eye type, may be easily overlooked in dark-skinned individuals, may be misdiagnosed, or may occur only with a second or subsequent infection. There may be flu-like symptoms with migratory musculoskeletal aches and pains. If a diagnosis of Lyme disease is made, the initial course of antibiotic treatment may not have been sufficient to eliminate the infection. (Although standardized by 1 set of guidelines, psychiatrists often see the failures of some of the "standard" treatments.) Low-grade symptoms may remit and periodically relapse over time. An accident, emotional stress, vaccination, or childbirth can trigger an exacerbation of symptoms.
The patient, who did not have psychosomatic symptoms and was not hypochondriacal in the past, now complains of an increasing number of somatic, cognitive, neurological, and psychiatric symptoms. Although Lyme disease may be suspected, the laboratory tests available to most clinicians often lack sensitivity and thus are read as negative for Lyme disease. Fibromyalgia, chronic fatigue syndrome, or multiple sclerosis (MS) may be erroneously diagnosed.
Treatment of some symptoms with corticosteroids may initially provide relief, but a more rapid decline often follows. The patient sees multiple specialists, each of whom restricts the examination to his area of expertise. Nothing is resolved, and the patient is frustrated that his symptoms cannot be explained. In view of the growing list of unexplained symptoms, including psychiatric symptoms, the patient is treated with tranquilizers and antidepressants with some benefit, but gradual decline persists. impairments, depression, anxiety, irritability, head-aches, and a multitude of other symptoms. When general medical treatment fails, the patient may be referred to a psychiatrist for 3 reasons: the unexplained medical symptoms give the appearance of a psychosomatic or somatoform condition; complex mental symptoms are thought to require psychiatric assessment; and a psychiatrist is thought to be needed to more effectively manage psychiatric treatments.
The Figure presents single photon emission CT (SPECT) images of the brain of a depressed 51-year-old woman with Lyme disease, before and after treatment with ceftriaxone. She walked on nature trails at home and on vacations, recalled frequent tick bites and an expanding bull's-eye rash on her abdomen with no other symptoms, but considered it of no special significance at the time. Over 8 years, there was a progressive development of unexplained symptoms that began with GI complaints, followed by cognitive impairment, fatigue, depression, arthritis, and shortness of breath. The primary diagnosis was atypical depression. Although the patient failed to respond to 51 different drug trials, the treating psychopharmacologist assured her the mental symptoms could not possibly be caused by an underlying physical condition.
The initial SPECT scan demonstrated "extensive hypoperfusion... predominantly in the frontal and temporal lobes and to a less degree in the parietal and occipital lobes," which is consistent with Lyme disease and neurodysfunction. Neurocognitive testing demonstrated significant abnormalities. An MRI scan ruled out frontal temporal dementia. The patient tested negative for Lyme disease by CDC epidemiological criteria, but the Lyme IgG Western blot test result was positive at one laboratory and equivocal at another. The CD57 lymphocyte count was low at 17/µL (60 to 360) and the patient tested positive for 4 other tick-borne infections (Mycoplasma fermentans, Babesia microti, Babesia WA-1, and Bartonella henselae). The patient was intolerant to oral antibiotics and was treated with 8 months of intravenous ceftriaxone. The second SPECT scan demonstrated "marked improvement of the hypoperfusion pattern in the temporal, frontal, and parietal lobes and small areas of hypoperfusion pattern remain." The depression never returned, but some mild residual symptoms persist, including fatigue, neuropathy, and arthritis; however, she has mostly returned to her active lifestyle. The failure to diagnose and treat these infections for several years resulted in an escalation of symptoms and a loss 8 years of her life that could have been prevented by earlier diagnosis and treatment.
General theoretical issues
The causes of most psychiatric illnesses are unknown. The catecholamine hypothesis does not adequately explain the cause of abnormal neurotransmitter functioning. Mendel stated that human traits are determined by individual genes that function independently of other genes and environmental influences. Koch believed that many human diseases are caused by microbes that exert their effect independently of other microbes, environmental factors, and genes. The cause of most mental illnesses cannot be explained by neurotransmitters, genes, or infections alone. Instead, as stated by Yolken,8
most common human diseases are caused by the interaction of environmental insults and susceptibility genes.Many of the susceptibility genes are diverse determinants of human response to environmental factors, including infections, and prevention or treatment of the infections may result in the effective treatment of complex disorders.
Neuropsychiatric disease is often associated with an interaction of environmental insults and susceptibility factors that frequently results in a pathological interaction including inflammation, oxidative stress, mitochondrial dysfunction, and excitotoxicity, which leads to neuronal dysfunction.3
Numerous studies document that infections, such as pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections, syphilis, hepatitis C, and zoonotic (animal) diseases, can cause mental illness.9-13 The same syndrome may be caused by different infections in different individuals, and the same infection can cause different syndromes in different individuals. For example, obsessive-compulsive disorder has been caused by infection with Streptococcus, B burgdorferi, Japanese B encephalitis virus, herpes simplex virus 1, Borna disease virus, Epstein-Barr virus, and Mycoplasma, as well as by thepandemic influenza of 191814-16; I have also observed cases caused by Hong Kong influenza and coxsackievirus infection. Of course, many of these infections have also been shown to cause other psychiatric and somatic symptoms. Some infections result in residual injury even after the infection itself no longer persists, while other infections may persist in a chronic relapsing and remitting state. Chronic infections are most commonly viral, venereal, and vector-borne zoonotic.8
Tick-borne diseases and chronic infectious diseases
B burgdorferi, the principal organism associated with Lyme borreliosis, is one of the most complex bacteria known to man. In addition, a tick bite can presumably transmit more than 1 disease-causing organism. Thus, 2 major clinical hurdles in diagnosis and management are the absence of a clear therapeutic end point in treating Lyme borreliosis and the potential presence of tick-borne coinfections that may complicate the course of the illness.3 The more common interactive coinfections may be caused by M fermentans, Mycoplasma pneumoniae, B microti, Ba- besia WA-1, Chlamydia pneumoniae, Ehrlichia, Anaplasma, and B henselae, and multiple viruses and fungi.2,3,17 When multiple microbes grow together, they can promote immunosuppressive effects and cause marked symbiotic changes that alter their functioning.18
Neuroborreliosis is an infection within the brain; however, infections in the body that do not pass through the blood-brain barrier may also impact the brain indirectly via immune effects. All the clinical manifestations, acute or chronic, of infection with B burgdorferi are characterized by strong inflammation with the production of several proinflammatory and anti-inflammatory cytokineswith an aberrant innate proinflammatory response19 and inflammatory brain changes.20 Most of the dysfunction caused by these infections is associated with immune reactions.
Lyme borreliosis and other tick-borne infections are associated with a combination of inflammatory reactions and autoimmune symptoms. The proinflammatory cytokines associated with these infections increase indoleamine 2,3-dioxygenase, which decreases serotonin and kynurenic acid, a neuroprotective glutamate antagonist. In addition, the cytokines increase the level ofquinolinic acid, an N-methyl d-aspartic acid (NMDA) agonist and neurotoxin, which contributes to the neurological and cognitive deficits seen in patients with tick-borne infections.21-23 This change may produce over-stimulation of hippocampal (NMDA) receptors leading to apoptosis and hippocampal atrophy. Hippocampal atrophy in the temporal lobes caused by NMDA overstimulation has been associated with depression and dementia.24
Lyme borreliosis and other tick-borne infections can exist as an asymptomatic chronic carrier state, they can present with occasional or chronic fluctuating low-level symptoms, or they can lead to severe multisystem dysfunction and a multitude of psychiatric presentations.2
Assessment
Some helpful screening questions for a person with suspected late or complicated B burgdorferi infection are listed in Table 2. Positive responses require a thorough history, review of systems, and assessment of cognitive, emotional, vegetative, behavioral, psychiatric, neurological, and somatic symptoms.
TABLE 2
Screening for suspected late or complicated Lyme disease
1. Do you live or have you vacationed in areas that may expose you to ticks?
2. Have you engaged in activities that may have exposed you to ticks? expectations
3. Have family members, neighbors, or the family dog been infected?
4. Is there a history of a tick bite, possibly with a flu-like illness and/or a bull's-eye or other rash?
5. Is there a point at which the patients health declined, followed by a relapsing progression and development of multisystemic symptoms, including cognitive, psychiatric, neurological, and physical symptoms?
6. Have antibiotics ever caused a sudden worsening followed by an improvement of symptoms?*
*Refer to Jarisch-Herxheimer reaction in Discussion section.
-----------------------------------------------------------------------------
Page 2: Lyme borreliosis
Page 1 | 2
Viimeksi muokannut soijuv, Ke Helmi 04, 2009 07:59. Yhteensä muokattu 1 kertaa.
Itävaltalainen tutkimus vuodelta 1997.
WHY IS CHRONIC LYME BORRELIOSIS CHRONIC?
Clinical Infectious Diseases 1997;25(suppl 1):S64-70
Elisabeth Aberer, Frieder Koszik, and Maria Silberer
From the Division of General Dermatology, Department of Dermatology, University of Graz Medical School, Graz; and the Vienna International Research Center and Division of Immunology, Allergy, and Infectious Diseases, Department of Dermatology, University of Vienna Medical School, Vienna, Austria
ABSTRACT: Chronic Lyme borreliosis (CLB) can present not only in different organs but also in different patterns. Although many theories exist about the mechanisms leading to CLB, it is known that viable Borrelia burgdorferi can persist for decades and cause late skin manifestations of acrodermatitis chronica atrophicans (ACA). Thus, the immunopathogenetic findings in ACA can serve as a model for studying the chronic course of Lyme borreliosis. Recent findings indicate that the most important cell for antigen presentation, the epidermal Langerhans cell (LC), is invaded by B. burgdorferi in early Lyme borreliosis. Therefore, LCs were stained immunohistochemically with different markers to investigate their functional activity. Numbers of CDla+ LCs were reduced in erythema migrans but normal or slightly elevated in ACA. In both diseases there was also a marked downregulation of major histocompatibility complex class II molecules on LCs, as measured by staining of human leukocyte antigen DR. This phenomenon might be a mechanism that protects against the presentation of autoantigens and may be the cause of the impaired capacity of LCs to eliminate B. burgdorferi antigens, thus explaining why CLB is chronic.
BACKGROUND: Lyme borreliosis is a multisystem inflammatory disease caused by Borrelia burgdorferi. Patients treated adequately with antibiotics in the early phase of infection show a good clinical response. However, the time of infection and mode of development of various organ manifestations often cannot be followed. Moreover, it is evident that the type of Borrelia strain and the immunosusceptibility of the host influence the expansion of clinical symptoms, which may explain differences between the manifestations of chronic Lyme borreliosis (CLB) seen in patients in the United States and Europe.
Several recent articles have described the symptoms of CLB [1-7].
Studies of CLB in the rhesus monkey model have revealed characteristic clinical, histopathologic, and laboratory findings [3]. Although not yet reported to occur in animal models, acrodermatitis chronica atrophicans (ACA) of the skin, caused by Borrelia afzelii, a subtype of B. burgdorferi sensu lato, develops gradually. Therefore, ACA may be a good model for studying the immunopathogenic events that lead to chronic disease.
HISTOPATHOLOGIC AND IMMUNOHISTOLOGIC FINDINGS IN THE SKIN
The first stage of Lyme borreliosis, erythema migrans, is a self-limited dermatosis. Nevertheless, the erythema can either persist and gradually progress into ACA over a period of months to years or can disappear. However, Borrelia organisms can survive in the skin, leading to chronic inflammation and thus causing ACA, the final stage of CLB.
At first, the cellular immune response seen locally in erythema migrans is mainly composed of CD3+ T cells, with a predominance of CD4+ helper/inducer cells, 3O%-40% CD8+ cytotoxic/suppressor T cells, and numerous macrophages [8]. The composition of this mononuclear infiltrate persists into the ACA stage. The percentage of CD4+ T lymphocytes, however, increases up to 9O% [8-1O]. Although the presence of many plasma cells is histologically pathognomonic, the predominance of CD22+/CD2O+ B cells varies 9, IO].
But what happens as a consequence of this active inflammation? Studies of persistent erythema migrans lesions have shown that the mononuclear cellular elements cluster around vessel walls. These findings, which can be compared with histologic changes in CLB as described with regard to various organs, are suggestive of an angiopathy accompanied by Iymphocytic infiltrate [3, 11]. Moreover, an interstitial myositis of the smooth arrector muscles of hair develops, and these gradually become atrophic in ACA [12]. Immunohistochemical studies have shown that in ACA, both the hair muscles and the muscle of vessel walls can no longer be stained with antibodies against smooth muscle actin [12].
Deposition of immunocomplexes in dermal vessel walls as well as granular IgM or C3 deposits can sometimes be seen at the dermoepidermal junction [1O]. The inflammatory infiltrate is also arranged interstitially between connective tissue fibers. Ultrastructurally, numerous macrophages are seen to engulf degenerated elastic and collagenous tissue, leading in turn to the degeneration of connective tissue [13, 14]. The basal kera tinoCytes show vacuolization, as also seen in lichen planus or graft-versus-host disease of the skin [1O, 13, 14].
The end stage of ACA is atrophy of epidermis, collagen, and elastic fibers. In half of the cases, ACA is associated with neuropathy Perineural Iymphocytic infiltrates severe enough to obliterate blood vessels, destroy myelinated fibers, and thus lead to axonal nerve degeneration are typical of this late mani-festation [15].
IMMUNE RESPONSE IN ACA
Patients with ACA mount an immune response but cannot eliminate the pathogen B. burgdorferi. In the sera of such patients, high titers of IgG antibody to B. burgdorferi can still be detected years after treatment [16, 17]. Although most of these antibodies are of the IgGI isotype, there is a distinct IgG2 and IgG3 component [18]. In a minority of patients, IgM antibodies can also be detected by ELISA [16], although these findings are mostly associated with a positive rheumatoid fac-tor. on the other hand, polyclonal hyperimmunoglob~rnemia, mostly of the IgM isotype, is often seen in ACA [19].
The cellular immune response of peripheral blood Iympho-cytes seen in CLB [2O] is not regularly found in ACA. For example, in lymphocyte proliferation tests performed by Breier et al. in 19 ACA patients, only 3 patients exhibited a marked stimulation index against viable B. burgdorferi subspecies gari-nii organisms, while 4 patients showed no stimulation at all [21]. In contrast, Buchner et al. reported positive Iympho-cyte transformation tests in most ACA patients when sonicated B. burgdorferi sensu stricto was used as antigen [22]. A similar test using B. afzelii as antigen has, to the best of our knowledge, not yet been performed. Since this strain has been isolated from patients with ACA, the highest proliferation rates could be expected if the latter strain were used as antigen.
The ROLE OF EPIDERMAL LANGERHANS CELLS
Antigen-presenting cells play a central role in immune de-fense mechanisms. One particular type of antigen-presenting cell, epidermal dendritic Langerhans cells (LCs), have been studied in several chronic infectious diseases, including syphi-lis, leprosy, leishmaniasis, and HIV infection [23-26]. Ultra-structural studies of skin biopsy specimens from patients with erythema migrans have shown that B. burgdorferi selectively invades and destroys LCs [27].
Moreover, recently performed in vitro studies proved that skin- and blood-derived dendritic cells are also able to effi-ciently engulf B. burgdorferi (Figueira L., Nestle F., Rittig M., Groscurth P. Phagocytosis and antigen-processing of B. burg-dorferi by human dendritic cells. Presented at the 4th Interna-tional Workshop on Langerhans Cells Venice]. october 1996, p. 132). Although intracellular survival of B. burgdorferi in LCs has not yet been described, the parasitism of LCs in the early stage of borreliosis suggests that their function might be altered in Lyme borreliosis.
In a recent study, skin biopsy specimens from seven patients with rythema migrans and 19 with ACA were investigated immunohistochemically for their expression of CDla?the most reliable antibody to identify LCs [28]?human major histocompatibility complex (MHC) human leukocyte antigen (HLA) subregions HLA-DR, -DQ, and -DP, and several other different leukocyte differentiation antigens. These studies were performed in order to determine whether the number or func-tion of epidermal LCs was altered (M. Silberer, F. Koszik, E. Aberer, manuscript in preparation).
Semiautomatic image analysis of CDla staining revealed a decreased density of epidermal LCs in erythema migrans sec-tions (598 + or- 24O per mm2 of epidermis), vs. a normal or even higher density in ACA sections (835 + or - 317/mm2) (figure 1), as compared with their density in normal skin (46O-I,OOO/ mm2 [29]).
More important, MHC class II molecule expression, as evaluated by HLA-DR expression, was considerably downregu-lated in erythema migrans and ACA (by 28% and 18%, respec-tively). In contrast, CD I a and HLA-DR were equally expressed in normal skin [29]. In addition, HLA-DP and -DQ molecules were downregulated on pidermal dendritic cells.
BACTERIAL ELIMINATION AND SURVIVAL
Recent experiments have shed light on the elimination and survival of borreliae. On the one hand, in vitro experiments have shown that borreliae are internalized by macrophages, catabolized in endosomes, loaded with MHC class II molecules, and then presented to CD4+ cells [3O]. On the other hand, uptake of borreliae by coiling phagocytosis has also been ob-served; the borreliae enter the cytosol and join the MHC class I pathway involving CD8+ suppressor/cytotoxic cells for Iysis.
Since the majority of infiltrating cells in the skin biopsies we investigated were of the CD4 helper/inducer type and since a high number of CD68+ macrophages in those samples also expressed HLA-DR, we think that the MHC class II pathway rather than the class I pathway is involved in immune defense mechanisms in ACA (Silberer M., Koszik F., Aberer E., manu-script in preparation).
Immunohistochemical staining of ACA skin biopsy speci-mens with a monoclonal antibody to flagellin has shown that ACA-affected skin harbors several forms of borreliae. Heavily stained, clumped, intertwined forms and granular Borrelia structures among collagen fibers (figure 2) are also seen to form after incubation with antibodies to B. burgdorferi in vitro, and delicate dispersed forms are found Iying in degenerating collagen fibers [31]. The existence of these forms has been confirmed ultrastructurally [27].
Previous studies have shown that ACA can be successfully treated with oral antibiotics given for 3O days [19]; the skin lesions regress slowly over the next 6-12 months. Repeated biopsies of ACA-affected skin from two patients treated with ceftriaxone for 15 days showed that one patient still had peri-vascular Iymphoplasmocytic infiltrates I year later, although no Borrelia DNA could be detected in the urine with a nested PCR method and flagellin primers [19].
In patients treated orally for only 2O days or intravenously for 15 days, either skin involvement or associated symptoms persisted. In 1O patients with ACA treated with a 30-day course of oral antibiotics, no Borrelia DNA fragments could be de-tected in the urine after 6 months, and all patients were free of further clinical symptoms at 12 months. In still other studies, PCR analysis of biopsy specimens of previous skin lesions at a median of l.5 years after treatment showed no sign of Bor-relia DNA [32].
Yet, the question still remains: where do Borrelia organisms survive in patients with CLB? An inadequate immune response and an evasion of bacteria into immunologically privileged sites may be the cause for microbial persistence. Recently, resistance to complement-mediated killing was reported fol-lowing the study of an in vitro model in which borreliae were cultured in rat joint tissue [33]. Moreover, survival of borreliae via targeting with fibronectin has been reported [33].
B. burgdorferi has been isolated from skin affected by ACA for >IO years [34], from joint fluids in a patient treated for facial palsy [3S], from the myocardium of another patient [36], and from joint tissue of a rhesus monkey 6 months after infec-tion [3]. Numerous researchers have detected Borrelia DNA in synovial fluid, CSF, urine, skin, and joint tissue from patients with chronic disease [36-39]. Ultrastructurally, B. burgdorferi has also been detected in ligamentous tissue [5].
The intracellular survival of borreliae in mouse macrophages has been suggested by Montgomery et al. [4O]. In rhesus mon-keys, staining deposits by two monoclonal antibodies to B. burgdorferi (a 7.S-kD lipoprotein and ospA LA-31) were detected in macrophages in infected but not control animals, by means of an immunoperoxidase method [3]. In our own immunohistochemical studies using the flagellar H9724-mono-clonal antibody, some macrophages stained positively for borreliae, not only in skin biopsy specimens from patients with ACA but also in control biopsy specimens from healthy individuals [31].These findings were interpreted as being due to crossreactive epitopes of the monoclonal flagellar antibody and several human tissue components [41].
WHY IS CHRONIC LYME BORRELIOSIS CHRONIC?
Clinical Infectious Diseases 1997;25(suppl 1):S64-70
Elisabeth Aberer, Frieder Koszik, and Maria Silberer
From the Division of General Dermatology, Department of Dermatology, University of Graz Medical School, Graz; and the Vienna International Research Center and Division of Immunology, Allergy, and Infectious Diseases, Department of Dermatology, University of Vienna Medical School, Vienna, Austria
ABSTRACT: Chronic Lyme borreliosis (CLB) can present not only in different organs but also in different patterns. Although many theories exist about the mechanisms leading to CLB, it is known that viable Borrelia burgdorferi can persist for decades and cause late skin manifestations of acrodermatitis chronica atrophicans (ACA). Thus, the immunopathogenetic findings in ACA can serve as a model for studying the chronic course of Lyme borreliosis. Recent findings indicate that the most important cell for antigen presentation, the epidermal Langerhans cell (LC), is invaded by B. burgdorferi in early Lyme borreliosis. Therefore, LCs were stained immunohistochemically with different markers to investigate their functional activity. Numbers of CDla+ LCs were reduced in erythema migrans but normal or slightly elevated in ACA. In both diseases there was also a marked downregulation of major histocompatibility complex class II molecules on LCs, as measured by staining of human leukocyte antigen DR. This phenomenon might be a mechanism that protects against the presentation of autoantigens and may be the cause of the impaired capacity of LCs to eliminate B. burgdorferi antigens, thus explaining why CLB is chronic.
BACKGROUND: Lyme borreliosis is a multisystem inflammatory disease caused by Borrelia burgdorferi. Patients treated adequately with antibiotics in the early phase of infection show a good clinical response. However, the time of infection and mode of development of various organ manifestations often cannot be followed. Moreover, it is evident that the type of Borrelia strain and the immunosusceptibility of the host influence the expansion of clinical symptoms, which may explain differences between the manifestations of chronic Lyme borreliosis (CLB) seen in patients in the United States and Europe.
Several recent articles have described the symptoms of CLB [1-7].
Studies of CLB in the rhesus monkey model have revealed characteristic clinical, histopathologic, and laboratory findings [3]. Although not yet reported to occur in animal models, acrodermatitis chronica atrophicans (ACA) of the skin, caused by Borrelia afzelii, a subtype of B. burgdorferi sensu lato, develops gradually. Therefore, ACA may be a good model for studying the immunopathogenic events that lead to chronic disease.
HISTOPATHOLOGIC AND IMMUNOHISTOLOGIC FINDINGS IN THE SKIN
The first stage of Lyme borreliosis, erythema migrans, is a self-limited dermatosis. Nevertheless, the erythema can either persist and gradually progress into ACA over a period of months to years or can disappear. However, Borrelia organisms can survive in the skin, leading to chronic inflammation and thus causing ACA, the final stage of CLB.
At first, the cellular immune response seen locally in erythema migrans is mainly composed of CD3+ T cells, with a predominance of CD4+ helper/inducer cells, 3O%-40% CD8+ cytotoxic/suppressor T cells, and numerous macrophages [8]. The composition of this mononuclear infiltrate persists into the ACA stage. The percentage of CD4+ T lymphocytes, however, increases up to 9O% [8-1O]. Although the presence of many plasma cells is histologically pathognomonic, the predominance of CD22+/CD2O+ B cells varies 9, IO].
But what happens as a consequence of this active inflammation? Studies of persistent erythema migrans lesions have shown that the mononuclear cellular elements cluster around vessel walls. These findings, which can be compared with histologic changes in CLB as described with regard to various organs, are suggestive of an angiopathy accompanied by Iymphocytic infiltrate [3, 11]. Moreover, an interstitial myositis of the smooth arrector muscles of hair develops, and these gradually become atrophic in ACA [12]. Immunohistochemical studies have shown that in ACA, both the hair muscles and the muscle of vessel walls can no longer be stained with antibodies against smooth muscle actin [12].
Deposition of immunocomplexes in dermal vessel walls as well as granular IgM or C3 deposits can sometimes be seen at the dermoepidermal junction [1O]. The inflammatory infiltrate is also arranged interstitially between connective tissue fibers. Ultrastructurally, numerous macrophages are seen to engulf degenerated elastic and collagenous tissue, leading in turn to the degeneration of connective tissue [13, 14]. The basal kera tinoCytes show vacuolization, as also seen in lichen planus or graft-versus-host disease of the skin [1O, 13, 14].
The end stage of ACA is atrophy of epidermis, collagen, and elastic fibers. In half of the cases, ACA is associated with neuropathy Perineural Iymphocytic infiltrates severe enough to obliterate blood vessels, destroy myelinated fibers, and thus lead to axonal nerve degeneration are typical of this late mani-festation [15].
IMMUNE RESPONSE IN ACA
Patients with ACA mount an immune response but cannot eliminate the pathogen B. burgdorferi. In the sera of such patients, high titers of IgG antibody to B. burgdorferi can still be detected years after treatment [16, 17]. Although most of these antibodies are of the IgGI isotype, there is a distinct IgG2 and IgG3 component [18]. In a minority of patients, IgM antibodies can also be detected by ELISA [16], although these findings are mostly associated with a positive rheumatoid fac-tor. on the other hand, polyclonal hyperimmunoglob~rnemia, mostly of the IgM isotype, is often seen in ACA [19].
The cellular immune response of peripheral blood Iympho-cytes seen in CLB [2O] is not regularly found in ACA. For example, in lymphocyte proliferation tests performed by Breier et al. in 19 ACA patients, only 3 patients exhibited a marked stimulation index against viable B. burgdorferi subspecies gari-nii organisms, while 4 patients showed no stimulation at all [21]. In contrast, Buchner et al. reported positive Iympho-cyte transformation tests in most ACA patients when sonicated B. burgdorferi sensu stricto was used as antigen [22]. A similar test using B. afzelii as antigen has, to the best of our knowledge, not yet been performed. Since this strain has been isolated from patients with ACA, the highest proliferation rates could be expected if the latter strain were used as antigen.
The ROLE OF EPIDERMAL LANGERHANS CELLS
Antigen-presenting cells play a central role in immune de-fense mechanisms. One particular type of antigen-presenting cell, epidermal dendritic Langerhans cells (LCs), have been studied in several chronic infectious diseases, including syphi-lis, leprosy, leishmaniasis, and HIV infection [23-26]. Ultra-structural studies of skin biopsy specimens from patients with erythema migrans have shown that B. burgdorferi selectively invades and destroys LCs [27].
Moreover, recently performed in vitro studies proved that skin- and blood-derived dendritic cells are also able to effi-ciently engulf B. burgdorferi (Figueira L., Nestle F., Rittig M., Groscurth P. Phagocytosis and antigen-processing of B. burg-dorferi by human dendritic cells. Presented at the 4th Interna-tional Workshop on Langerhans Cells Venice]. october 1996, p. 132). Although intracellular survival of B. burgdorferi in LCs has not yet been described, the parasitism of LCs in the early stage of borreliosis suggests that their function might be altered in Lyme borreliosis.
In a recent study, skin biopsy specimens from seven patients with rythema migrans and 19 with ACA were investigated immunohistochemically for their expression of CDla?the most reliable antibody to identify LCs [28]?human major histocompatibility complex (MHC) human leukocyte antigen (HLA) subregions HLA-DR, -DQ, and -DP, and several other different leukocyte differentiation antigens. These studies were performed in order to determine whether the number or func-tion of epidermal LCs was altered (M. Silberer, F. Koszik, E. Aberer, manuscript in preparation).
Semiautomatic image analysis of CDla staining revealed a decreased density of epidermal LCs in erythema migrans sec-tions (598 + or- 24O per mm2 of epidermis), vs. a normal or even higher density in ACA sections (835 + or - 317/mm2) (figure 1), as compared with their density in normal skin (46O-I,OOO/ mm2 [29]).
More important, MHC class II molecule expression, as evaluated by HLA-DR expression, was considerably downregu-lated in erythema migrans and ACA (by 28% and 18%, respec-tively). In contrast, CD I a and HLA-DR were equally expressed in normal skin [29]. In addition, HLA-DP and -DQ molecules were downregulated on pidermal dendritic cells.
BACTERIAL ELIMINATION AND SURVIVAL
Recent experiments have shed light on the elimination and survival of borreliae. On the one hand, in vitro experiments have shown that borreliae are internalized by macrophages, catabolized in endosomes, loaded with MHC class II molecules, and then presented to CD4+ cells [3O]. On the other hand, uptake of borreliae by coiling phagocytosis has also been ob-served; the borreliae enter the cytosol and join the MHC class I pathway involving CD8+ suppressor/cytotoxic cells for Iysis.
Since the majority of infiltrating cells in the skin biopsies we investigated were of the CD4 helper/inducer type and since a high number of CD68+ macrophages in those samples also expressed HLA-DR, we think that the MHC class II pathway rather than the class I pathway is involved in immune defense mechanisms in ACA (Silberer M., Koszik F., Aberer E., manu-script in preparation).
Immunohistochemical staining of ACA skin biopsy speci-mens with a monoclonal antibody to flagellin has shown that ACA-affected skin harbors several forms of borreliae. Heavily stained, clumped, intertwined forms and granular Borrelia structures among collagen fibers (figure 2) are also seen to form after incubation with antibodies to B. burgdorferi in vitro, and delicate dispersed forms are found Iying in degenerating collagen fibers [31]. The existence of these forms has been confirmed ultrastructurally [27].
Previous studies have shown that ACA can be successfully treated with oral antibiotics given for 3O days [19]; the skin lesions regress slowly over the next 6-12 months. Repeated biopsies of ACA-affected skin from two patients treated with ceftriaxone for 15 days showed that one patient still had peri-vascular Iymphoplasmocytic infiltrates I year later, although no Borrelia DNA could be detected in the urine with a nested PCR method and flagellin primers [19].
In patients treated orally for only 2O days or intravenously for 15 days, either skin involvement or associated symptoms persisted. In 1O patients with ACA treated with a 30-day course of oral antibiotics, no Borrelia DNA fragments could be de-tected in the urine after 6 months, and all patients were free of further clinical symptoms at 12 months. In still other studies, PCR analysis of biopsy specimens of previous skin lesions at a median of l.5 years after treatment showed no sign of Bor-relia DNA [32].
Yet, the question still remains: where do Borrelia organisms survive in patients with CLB? An inadequate immune response and an evasion of bacteria into immunologically privileged sites may be the cause for microbial persistence. Recently, resistance to complement-mediated killing was reported fol-lowing the study of an in vitro model in which borreliae were cultured in rat joint tissue [33]. Moreover, survival of borreliae via targeting with fibronectin has been reported [33].
B. burgdorferi has been isolated from skin affected by ACA for >IO years [34], from joint fluids in a patient treated for facial palsy [3S], from the myocardium of another patient [36], and from joint tissue of a rhesus monkey 6 months after infec-tion [3]. Numerous researchers have detected Borrelia DNA in synovial fluid, CSF, urine, skin, and joint tissue from patients with chronic disease [36-39]. Ultrastructurally, B. burgdorferi has also been detected in ligamentous tissue [5].
The intracellular survival of borreliae in mouse macrophages has been suggested by Montgomery et al. [4O]. In rhesus mon-keys, staining deposits by two monoclonal antibodies to B. burgdorferi (a 7.S-kD lipoprotein and ospA LA-31) were detected in macrophages in infected but not control animals, by means of an immunoperoxidase method [3]. In our own immunohistochemical studies using the flagellar H9724-mono-clonal antibody, some macrophages stained positively for borreliae, not only in skin biopsy specimens from patients with ACA but also in control biopsy specimens from healthy individuals [31].These findings were interpreted as being due to crossreactive epitopes of the monoclonal flagellar antibody and several human tissue components [41].
Osa suomalaistutkijoista/lääkäreistä myöntää nyt borreliabakteerin kykenevän pakenemaan eri puolille elimistöä ja pysyvän siellä jopa vuosikausia. Norjalaiset Brorsonit ovat jo vuosia esittäneet tutkimuksissaan borreliabakteerin muuntumisen kystamuotoon esim. silloin kun se laitettiin tislattuun veteen. Tutkijat odottivat 6 vuotta ja laittoivat bakteerin sen jälkeen ravinneliuokseen. Kysta aukesi ja siitä tuli eläviä spirokeettoja.
Allaolevat suomalaistutkijat (Oksi, Viljanen, Savolainen, Laippala) tulivat myös siihen tulokseen, että borreliabakteeri kykenee aktivoitumaan uudelleen latentin kauden jälkeen. Lopputulokseksi tuli, että potilaiden jatkuvien oireiden syynä on krooninen infektio.
Turku Immunology Centre
http://www.med.utu.fi/mikrobiologia/tut ... ljanen.pdf
Lyme borreliosis is a tick-transmitted disease caused by the spirochete Borrelia burgdorferi. During the early infection the spirochete spreads in the skin leading within a few days to a typical ring-like erythema migrans lesion. In some individuals, the infection is limited to the skin and subsides even without treatment. However,
in some cases the spirochete invades into the blood and disseminates into various organs, where it may survive and persist for months or even years. The main aim of this project is to understand the mechanisms how borrelia manages to evade the first line immune response and spreads into a multi-organ infection. We
further aim to elucidate the mechanisms of persistent and treatment resistant Lyme borreliosis, since these disease manifestations can lead to complicated and expensive investigations, delayed diagnosis and longstanding disability of the patients.
The histological picture of erythema migrans lesion is mainly lymphocytic with very few neutrophils, which is in striking contrast with other bacterial infections of the skin. Our hypothesis is that borrelia interferes with the function of dendritic cells and thus prevents the
recruitment of neutrophils to the site of infection. Using large-scale gene expression studies we want to find out whether borrelia somehow manipulates neutrophils and dendritic cells to its benefit. The phagocytosis of borrelia takes place through ?tube-phagocytosis?.
We want to elucidate the cellular mechanisms of this interesting phenomenon by studying the receptors and signalling pathways involved in the process.
One of the most debated questions in Lyme borreliosis research is pathogenesis of antibiotic treatment resistant disease manifestations. Two main hypotheses presented to explain this phenomenon are persistent infection and infection-induced autoimmunity. We have succeeded in establishing a much-needed animal model for this disease entity (Yrjänäinen et al., submitted).
Our results show that the presence of vegetative spirochetes is no
prerequisite for the persisting symptoms. However, using this model we have found out that when the mice receive immunosuppressive treatment with anti-TNF-α after a latent period of several weeks, borreliae are activated from a dormant state and the animals develop spirochetemia (Yrjänäinen et al., manuscript in preparation).
Thus, our results support the persistent infection hypothesis.
Our mouse model makes possible to investigate where the microbe is
hiding during latency, how it is adapted to latency, how the microbe can be evicted from its hiding places, and how the immune response of the host behaves during latency. In this investigation, we use, among other methods, both mouse and borrelia gene arrays and modern imaging methods (e.g. livecell confocal microscopy, molecular PET etc.).
These studies should provide novel information concerning the pathogenesis and possible therapeutic approaches of antibiotic treatment resistant Lyme arthritis and Lyme borreliosis in general. The results may have an impact also on the understanding of other persistent infections like tuberculosis, chlamydia infections and certain viral diseases.
Recent publications:
Suhonen, J., Komi, J., Soukka, J., Lassila, O. and Viljanen, M.K. (2003) Interaction between Borrelia burgdorferi
and immature human dendritic cells. Scand. J. Immunol. 58: 67-75.
Suhonen, J., Hartiala, K., Tuominen-Gustafsson, H. and Viljanen, M.K. (2002) Sublethal concentrations of
complement can effectively opsonize Borrelia burgdorferi. Scand. J. Immunol. 56: 554-560.
Suhonen, J., Hartiala, K., Tuominen-Gustafsson, H. and Viljanen, M.K. (2000) Borrelia burgdorferi -induced
oxidative burst, calcium mobilization, and phagocytosis of human neutrophils are complement dependent. J.
Infect. Dis. 181: 195-202.
Suhonen, J., Hartiala, K. and Viljanen, M.K. (1998) Tube phagocytosis, a novel way for neutrophils to
phagocytize Borrelia burgdorferi. Infect. Immun. 66: 3433-3435.
Oksi, J., Savolainen, J., Pene, J., Bousquet, J., Laippala, P. and Viljanen, M.K. (1996) Decreased interleukin-4
and increased gamma interferon production by peripheral blood mononuclear cells of patients with Lyme
borreliosis. Infect. Immun. 64: 3620-3623.
Allaolevat suomalaistutkijat (Oksi, Viljanen, Savolainen, Laippala) tulivat myös siihen tulokseen, että borreliabakteeri kykenee aktivoitumaan uudelleen latentin kauden jälkeen. Lopputulokseksi tuli, että potilaiden jatkuvien oireiden syynä on krooninen infektio.
Turku Immunology Centre
http://www.med.utu.fi/mikrobiologia/tut ... ljanen.pdf
Lyme borreliosis is a tick-transmitted disease caused by the spirochete Borrelia burgdorferi. During the early infection the spirochete spreads in the skin leading within a few days to a typical ring-like erythema migrans lesion. In some individuals, the infection is limited to the skin and subsides even without treatment. However,
in some cases the spirochete invades into the blood and disseminates into various organs, where it may survive and persist for months or even years. The main aim of this project is to understand the mechanisms how borrelia manages to evade the first line immune response and spreads into a multi-organ infection. We
further aim to elucidate the mechanisms of persistent and treatment resistant Lyme borreliosis, since these disease manifestations can lead to complicated and expensive investigations, delayed diagnosis and longstanding disability of the patients.
The histological picture of erythema migrans lesion is mainly lymphocytic with very few neutrophils, which is in striking contrast with other bacterial infections of the skin. Our hypothesis is that borrelia interferes with the function of dendritic cells and thus prevents the
recruitment of neutrophils to the site of infection. Using large-scale gene expression studies we want to find out whether borrelia somehow manipulates neutrophils and dendritic cells to its benefit. The phagocytosis of borrelia takes place through ?tube-phagocytosis?.
We want to elucidate the cellular mechanisms of this interesting phenomenon by studying the receptors and signalling pathways involved in the process.
One of the most debated questions in Lyme borreliosis research is pathogenesis of antibiotic treatment resistant disease manifestations. Two main hypotheses presented to explain this phenomenon are persistent infection and infection-induced autoimmunity. We have succeeded in establishing a much-needed animal model for this disease entity (Yrjänäinen et al., submitted).
Our results show that the presence of vegetative spirochetes is no
prerequisite for the persisting symptoms. However, using this model we have found out that when the mice receive immunosuppressive treatment with anti-TNF-α after a latent period of several weeks, borreliae are activated from a dormant state and the animals develop spirochetemia (Yrjänäinen et al., manuscript in preparation).
Thus, our results support the persistent infection hypothesis.
Our mouse model makes possible to investigate where the microbe is
hiding during latency, how it is adapted to latency, how the microbe can be evicted from its hiding places, and how the immune response of the host behaves during latency. In this investigation, we use, among other methods, both mouse and borrelia gene arrays and modern imaging methods (e.g. livecell confocal microscopy, molecular PET etc.).
These studies should provide novel information concerning the pathogenesis and possible therapeutic approaches of antibiotic treatment resistant Lyme arthritis and Lyme borreliosis in general. The results may have an impact also on the understanding of other persistent infections like tuberculosis, chlamydia infections and certain viral diseases.
Recent publications:
Suhonen, J., Komi, J., Soukka, J., Lassila, O. and Viljanen, M.K. (2003) Interaction between Borrelia burgdorferi
and immature human dendritic cells. Scand. J. Immunol. 58: 67-75.
Suhonen, J., Hartiala, K., Tuominen-Gustafsson, H. and Viljanen, M.K. (2002) Sublethal concentrations of
complement can effectively opsonize Borrelia burgdorferi. Scand. J. Immunol. 56: 554-560.
Suhonen, J., Hartiala, K., Tuominen-Gustafsson, H. and Viljanen, M.K. (2000) Borrelia burgdorferi -induced
oxidative burst, calcium mobilization, and phagocytosis of human neutrophils are complement dependent. J.
Infect. Dis. 181: 195-202.
Suhonen, J., Hartiala, K. and Viljanen, M.K. (1998) Tube phagocytosis, a novel way for neutrophils to
phagocytize Borrelia burgdorferi. Infect. Immun. 66: 3433-3435.
Oksi, J., Savolainen, J., Pene, J., Bousquet, J., Laippala, P. and Viljanen, M.K. (1996) Decreased interleukin-4
and increased gamma interferon production by peripheral blood mononuclear cells of patients with Lyme
borreliosis. Infect. Immun. 64: 3620-3623.
Suomen Akatemian tiedote 4.6.2008
http://www.aka.fi/fi/A/Suomen-Akatemia/ ... iooteilta/
Punkin levittämä Borrelia-bakteeri suojautuu antibiooteilta
Lymen borrelioosia aiheuttava Borrelia-bakteeri on taitava suojautumaan antibiooteilta. Koetilanteessa se säilyi hengissä piiloutumalla hiiren nivelkudokseen. ?Bakteeri voi olla piilossa jopa useita viikkoja ja tulla esille antibioottihoidon jälkeen. Hoidon jälkeen Borrelian DNA:ta löytyy kuitenkin vain nivelkudoksesta, kun ennen hoitoa sitä löytyy lähes kaikkialta elimistöstä?, professori Matti K. Viljanen Turun yliopistosta sanoo.
Suomen Akatemian rahoittamassa tutkimuksessa on Viljasen johdolla pyritty selvittämään, miten borrelia onnistuu väistämään immuunipuolustuksen ja leviämään ihosta eri elimiin. Samalla on tutkittu, miten borrelioosin antibioottihoitoon reagoimaton krooninen ja vaikeastikin invalidisoiva tautimuoto syntyy. ?Ei kuitenkaan voida olla varmoja siitä, että ihmisillä taudin krooniset oireet välttämättä perustuvat samoihin mekanismeihin kuin hiirillä, vaikka bakteeria onkin löydetty hoidetuista potilaista. Noin 10 prosentilla potilaista niveloireet jatkuvat antibioottihoidosta huolimatta.?
Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa
Borrelia-bakteeri aiheuttaa maailmanlaajuisesti merkittävintä punkkien levittämää tautia, Lymen borrelioosia. Euroopassa tautitapauksia on vuosittain kymmeniä tuhansia ja Suomessa muutamia tuhansia. ?Bakteeria levittävät punkit, joita Suomessa kutsutaan puutiaisiksi. Punkkeja on runsaasti Ahvenanmaalla, muualla saaristossa ja Etelä-Suomen rannikolla. Paikoitellen punkkeja esiintyy aina napapiirin korkeudella asti. Punkkien borreliakantajuudet vaihtelevat suuresti. Tutkimuksemme mukaan Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa?, Viljanen kertoo.
?Taudin alkuvaiheessa punkin pureman mukana ihmisen ihoon siirtyneet bakteerit leviävät ihossa aiheuttaen taudille tyypillisen rengasmaisesti laajenevan punoittavan ihottuman. Monilla infektio rajoittuu ihoon ja paranee itsestään. Osalla potilaista borrelia kuitenkin väistää immuunipuolustuksen ja leviää ilman antibioottihoitoa eri elimiin ja voi aiheuttaa kroonisen taudin. Selvitämme parhaillaan, voidaanko eri antibiooteilla, pitkällä hoidolla tai antibiootteja yhdistelemällä borrelia tuhota sen piiloutumisyrityksistä huolimatta?, Viljanen sanoo.
Lisätietoja
- bakteeriopin professori Matti K. Viljanen, p. (02) 333 7330, matti.viljanen (at) utu.fi
Suomen Akatemian viestintä
tiedottaja Outi Jalonen
p. (09) 7748 8327, 040 359 2936
outi.jalonen (at) aka.fi
http://www.aka.fi/fi/A/Suomen-Akatemia/ ... iooteilta/
Punkin levittämä Borrelia-bakteeri suojautuu antibiooteilta
Lymen borrelioosia aiheuttava Borrelia-bakteeri on taitava suojautumaan antibiooteilta. Koetilanteessa se säilyi hengissä piiloutumalla hiiren nivelkudokseen. ?Bakteeri voi olla piilossa jopa useita viikkoja ja tulla esille antibioottihoidon jälkeen. Hoidon jälkeen Borrelian DNA:ta löytyy kuitenkin vain nivelkudoksesta, kun ennen hoitoa sitä löytyy lähes kaikkialta elimistöstä?, professori Matti K. Viljanen Turun yliopistosta sanoo.
Suomen Akatemian rahoittamassa tutkimuksessa on Viljasen johdolla pyritty selvittämään, miten borrelia onnistuu väistämään immuunipuolustuksen ja leviämään ihosta eri elimiin. Samalla on tutkittu, miten borrelioosin antibioottihoitoon reagoimaton krooninen ja vaikeastikin invalidisoiva tautimuoto syntyy. ?Ei kuitenkaan voida olla varmoja siitä, että ihmisillä taudin krooniset oireet välttämättä perustuvat samoihin mekanismeihin kuin hiirillä, vaikka bakteeria onkin löydetty hoidetuista potilaista. Noin 10 prosentilla potilaista niveloireet jatkuvat antibioottihoidosta huolimatta.?
Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa
Borrelia-bakteeri aiheuttaa maailmanlaajuisesti merkittävintä punkkien levittämää tautia, Lymen borrelioosia. Euroopassa tautitapauksia on vuosittain kymmeniä tuhansia ja Suomessa muutamia tuhansia. ?Bakteeria levittävät punkit, joita Suomessa kutsutaan puutiaisiksi. Punkkeja on runsaasti Ahvenanmaalla, muualla saaristossa ja Etelä-Suomen rannikolla. Paikoitellen punkkeja esiintyy aina napapiirin korkeudella asti. Punkkien borreliakantajuudet vaihtelevat suuresti. Tutkimuksemme mukaan Helsingin ulkoilualueilla noin joka kolmas punkki kantaa borreliaa?, Viljanen kertoo.
?Taudin alkuvaiheessa punkin pureman mukana ihmisen ihoon siirtyneet bakteerit leviävät ihossa aiheuttaen taudille tyypillisen rengasmaisesti laajenevan punoittavan ihottuman. Monilla infektio rajoittuu ihoon ja paranee itsestään. Osalla potilaista borrelia kuitenkin väistää immuunipuolustuksen ja leviää ilman antibioottihoitoa eri elimiin ja voi aiheuttaa kroonisen taudin. Selvitämme parhaillaan, voidaanko eri antibiooteilla, pitkällä hoidolla tai antibiootteja yhdistelemällä borrelia tuhota sen piiloutumisyrityksistä huolimatta?, Viljanen sanoo.
Lisätietoja
- bakteeriopin professori Matti K. Viljanen, p. (02) 333 7330, matti.viljanen (at) utu.fi
Suomen Akatemian viestintä
tiedottaja Outi Jalonen
p. (09) 7748 8327, 040 359 2936
outi.jalonen (at) aka.fi
-Borrelioosi on sairaus joka vaikuttaa useisiin elimiin ja aiheuttaa mitä moninaisimpia oireita. Joidenkin sairastuneiden kohdalla tauti saattaa kroonistua ja aiheuttaa pysyviä vaurioita vaikka he olisivat saaneet antibioottihoitoja. Borreliabakteeri (Bgarinii) vaikuttaa merkittävästi immuunipuolustukseen - dendriittisolujen toimintaan.
-3 viikon keftriaksonihoidon jälkeisestä suun kautta otetusta antibioottihoidosta ei ollut hyötyä edenneen borrelioosin hoidossa. Lopullisen hoitovasteen arviointi tulisi suorittaa 6 -12 kk:n kuluttua hoidosta. Kroonistuneissa tapauksissa jatkuvat positiiviset vasta-ainearvot eivät tarjoa lisätietoa tulevia hoitoja silmälläpitäen.
- Osalla hiiristä löytyi edelleen spirokeettoja elimistöstä viiden päivän keftriaksonihoidon jälkeen.
- Hiirillä esiintyi jatkuvia nivel- ja akillesjänneoireita huolimatta siitä olivatko ne saaneet antibioottihoidon (keftriaksoni) vai eivät. Antibioottihoidolla ei ollut myöskään vaikutusta vasta-aineiden esiintymiseen."
Hartiala P, Hytönen J, Pelkonen J, Kimppa K, West A, Penttinen MA, Suhonen J, Lahesmaa R, Viljanen MK. (2007). ?Transcriptional response of human dendritic cells to Borrelia garinii ? defective CD38 and CCR7 expression detected�?. J Leukocyte Biol 82: (1); 33-43. [C]
http://www.jleukbio.org/cgi/content/abstract/82/1/33 '
?Lyme borreliosis is a disease, which can affect several organs and cause a variety of symptoms. In some patients, the infection may become chronic, even after antibiotic therapy, and cause persisting damage. Dendritic cells (DC) are involved in the initiation of innate and adaptive immune responses. To study interactions between Borrelia garinii (Bg), one of the causative agents of Lyme borreliosis, and human DC, we used a cDNA microarray to compare the Bg-induced DC transcriptional response with the response induced by LPS. The Bg-induced response consisted of a smaller number of genes than the LPS-induced response. The microarray showed that the ectoenzyme CD38, which has an important role in DC chemotaxis and migration to lymph nodes, was strongly up-regulated by LPS but practically not at all by Bg. This finding was confirmed with quantitative RT-PCR and with flow cytometry at the protein level. In addition, RT-PCR showed that CCR7 expression was 11-fold greater in LPS-stimulated than in Bg-stimulated cells.
These findings suggest that Bg may affect crucial DC functions by blocking the up-regulation of important molecules in DC migration to lymph nodes, thus affecting further immune responses in Lyme borreliosis infection?.
· ?Duration of antibiotic treatment in disseminated Lyme borreliosis: a double-blind, randomized, placebo-controlled, multicenter clinical study
Oksi J, Nikoskelainen J, Hiekkanen H, Lauhio A, Peltomaa M, Pitkäranta A, Nyman D, Granlund H, Carlsson S-A, Seppälä I, Valtonen V, Viljanen M. (2007) �?. Eur J Clin Microbiol Infect Dis 26: 571-581. [C]
http://www.springerlink.com/content/q247x8101p26qhw5/
?Despite rather strict recommendations for antibiotic treatment of disseminated Lyme borreliosis (LB), evidence-based studies on the duration of antibiotic treatment are scarce. The aim of this multicenter study was to determine whether initial treatment with intravenous ceftriaxone (CRO) for 3 weeks should be extended with a period of adjunct oral antibiotic therapy. A total of 152 consecutive patients with LB were randomized in a double-blind fashion to receive either amoxicillin (AMOX) 1 g or placebo (PBO) twice daily for 100 days. Both groups received an initial treatment of intravenous CRO 2 g daily for 3 weeks, followed by the randomized drug or PBO. The outcome was evaluated using the visual analogue scale at the follow-up visits. The final analysis included 145 patients, of whom 73 received AMOX and 72 PBO. Diagnoses of LB were categorized as either definite or possible, on the basis of symptoms, signs, and laboratory results. The diagnosis was definite in 52 of the 73 (71.2%) AMOX-treated patients and in 54 of the 72 (75%) PBO patients. Of the patients with definite diagnoses, 62 had neuroborreliosis, 45 arthritis or other musculoskeletal manifestations, and 4 other manifestations of LB. As judged by the visual analogue scale and patient records, the outcome after a 1-year follow-up period was excellent or good in 114 (78.6%) patients, controversial in 14 (9.7%) patients, and poor in 17 (11.7%) patients. In patients with definite LB, the outcome was excellent or good in 49 (92.5%) AMOX-treated patients and 47 (87.0%) PBO patients and poor in 3 (5.7%) AMOX-treated patients and 6 (11.1%) PBO patients (difference nonsignificant, p = 0.49). Twelve months after the end of intravenous antibiotic therapy, the levels of antibodies against Borrelia burgdorferi were markedly decreased in 50% of the patients with definite LB in both groups. The results indicate that oral adjunct antibiotics are not justified in the treatment of patients with disseminated LB who initially receive intravenous CRO for 3 weeks. The clinical outcome cannot be evaluated at the completion of intravenous antibiotic treatment but rather 6?12 months afterwards. In patients with chronic post-treatment symptoms, persistent positive levels of antibodies do not seem to provide any useful information for further care of the patient.?
· Yrjänäinen H, Hytönen J, Song XRm Oksi J, Hartiala K, Viljanen MK. (2007). ?Anti-tumor necrosis factor-α treatment activates Borrelia burgdorferi spirochetes 4 weeks after ceftriaxone treatment in C3H/He mice�?. J Infect Dis 195: 1489-1496. [C]
http://www.journals.uchicago.edu/doi/abs/10.1086/513873
Background. The effect of anti-tumor necrosis factor (TNF)-α treatment in Borrelia burgdorferi-infected and ceftriaxone-treated C3H/He mice was evaluated.
Methods. Mice were infected with B. garinii Å218 or B. burgdorferi sensu stricto N40. At 2 weeks of infection, one group was treated simultaneously with ceftriaxone and anti-TNF-α, whereas another received ceftriaxone at 2 weeks and anti-TNF-α 4 weeks later. One group received ceftriaxone treatment only. Infected and noninfected control groups were sham treated.
Results. At 14 weeks of infection, B. burgdorferi could not be detected by cultivation or by polymerase chain reaction in tissue samples of any mouse treated with ceftriaxone only. However, spirochetes grew from the tissue samples of one-third of the mice treated with anti-TNF-α simultaneously or 4 weeks after ceftriaxone. These activated spirochetes showed ceftriaxone sensitivity rates, plasmid profiles, and virulence rates similar to those of bacteria used to infect the mice. All infected control mice and mice given anti-TNF-α only were culture positive.
Conclusions. This report shows that, after ceftriaxone treatment for 5 days, a portion of B. burgdorferi-infected mice still have live spirochetes in their body, which are activated by anti-TNF-α treatment.
· Yrjänäinen, H., Hytönen, J., Söderström, K.-O., Oksi, J., Hartiala, K., Viljanen, M.K. (2006). "Persistent joint swelling and borrelia-specific antibodies in Borrelia garinii-infected mice after eradication of vegetative spirochetes with antibiotic treatment." Microbes and Infection 8: 2044-51. [C]
http://www.ncbi.nlm.nih.gov/pubmed/16797205
?We wanted to study the pathogenesis and the long-term manifestations of Borrelia garinii infection in SJL and C3H/He mice. We report here that B. garinii A218 causes a persisting infection in these mouse strains. Mice infected with intracutaneous inoculation of B. garinii at 4-5 weeks of age developed a disseminated infection and joint swelling within 2 weeks of inoculation and remained infected with joint symptoms until the end of follow-ups of up to 52 weeks. Treatment with ceftriaxone or ampicillin at 18 or 44 weeks of infection did not affect the joint swelling during the follow-ups of 19 and 8 weeks, respectively. However, B. garinii could not be cultured from any of the post mortem tissue samples of the treated mice, whereas the spirochete grew from samples of all untreated infected animals. Borrelia-specific IgG antibodies were detectable after 2 weeks of infection, and in late infection, all mice had high anti-borrelia IgG levels. Antibiotic treatment had no effect on antibody levels. Histology showed only slight changes in the joints of the infected mice with occasional lymphocyte infiltration, synovial proliferation and slight involvement of the Achilles' tendon. No difference was seen in the findings between ceftriaxone-treated and untreated mice. The results suggest that the presence of vegetative spirochetes is no prerequisite for persisting joint symptoms and elevated anti-borrelia IgG levels in these B. garinii-infected mice.?
-3 viikon keftriaksonihoidon jälkeisestä suun kautta otetusta antibioottihoidosta ei ollut hyötyä edenneen borrelioosin hoidossa. Lopullisen hoitovasteen arviointi tulisi suorittaa 6 -12 kk:n kuluttua hoidosta. Kroonistuneissa tapauksissa jatkuvat positiiviset vasta-ainearvot eivät tarjoa lisätietoa tulevia hoitoja silmälläpitäen.
- Osalla hiiristä löytyi edelleen spirokeettoja elimistöstä viiden päivän keftriaksonihoidon jälkeen.
- Hiirillä esiintyi jatkuvia nivel- ja akillesjänneoireita huolimatta siitä olivatko ne saaneet antibioottihoidon (keftriaksoni) vai eivät. Antibioottihoidolla ei ollut myöskään vaikutusta vasta-aineiden esiintymiseen."
Hartiala P, Hytönen J, Pelkonen J, Kimppa K, West A, Penttinen MA, Suhonen J, Lahesmaa R, Viljanen MK. (2007). ?Transcriptional response of human dendritic cells to Borrelia garinii ? defective CD38 and CCR7 expression detected�?. J Leukocyte Biol 82: (1); 33-43. [C]
http://www.jleukbio.org/cgi/content/abstract/82/1/33 '
?Lyme borreliosis is a disease, which can affect several organs and cause a variety of symptoms. In some patients, the infection may become chronic, even after antibiotic therapy, and cause persisting damage. Dendritic cells (DC) are involved in the initiation of innate and adaptive immune responses. To study interactions between Borrelia garinii (Bg), one of the causative agents of Lyme borreliosis, and human DC, we used a cDNA microarray to compare the Bg-induced DC transcriptional response with the response induced by LPS. The Bg-induced response consisted of a smaller number of genes than the LPS-induced response. The microarray showed that the ectoenzyme CD38, which has an important role in DC chemotaxis and migration to lymph nodes, was strongly up-regulated by LPS but practically not at all by Bg. This finding was confirmed with quantitative RT-PCR and with flow cytometry at the protein level. In addition, RT-PCR showed that CCR7 expression was 11-fold greater in LPS-stimulated than in Bg-stimulated cells.
These findings suggest that Bg may affect crucial DC functions by blocking the up-regulation of important molecules in DC migration to lymph nodes, thus affecting further immune responses in Lyme borreliosis infection?.
· ?Duration of antibiotic treatment in disseminated Lyme borreliosis: a double-blind, randomized, placebo-controlled, multicenter clinical study
Oksi J, Nikoskelainen J, Hiekkanen H, Lauhio A, Peltomaa M, Pitkäranta A, Nyman D, Granlund H, Carlsson S-A, Seppälä I, Valtonen V, Viljanen M. (2007) �?. Eur J Clin Microbiol Infect Dis 26: 571-581. [C]
http://www.springerlink.com/content/q247x8101p26qhw5/
?Despite rather strict recommendations for antibiotic treatment of disseminated Lyme borreliosis (LB), evidence-based studies on the duration of antibiotic treatment are scarce. The aim of this multicenter study was to determine whether initial treatment with intravenous ceftriaxone (CRO) for 3 weeks should be extended with a period of adjunct oral antibiotic therapy. A total of 152 consecutive patients with LB were randomized in a double-blind fashion to receive either amoxicillin (AMOX) 1 g or placebo (PBO) twice daily for 100 days. Both groups received an initial treatment of intravenous CRO 2 g daily for 3 weeks, followed by the randomized drug or PBO. The outcome was evaluated using the visual analogue scale at the follow-up visits. The final analysis included 145 patients, of whom 73 received AMOX and 72 PBO. Diagnoses of LB were categorized as either definite or possible, on the basis of symptoms, signs, and laboratory results. The diagnosis was definite in 52 of the 73 (71.2%) AMOX-treated patients and in 54 of the 72 (75%) PBO patients. Of the patients with definite diagnoses, 62 had neuroborreliosis, 45 arthritis or other musculoskeletal manifestations, and 4 other manifestations of LB. As judged by the visual analogue scale and patient records, the outcome after a 1-year follow-up period was excellent or good in 114 (78.6%) patients, controversial in 14 (9.7%) patients, and poor in 17 (11.7%) patients. In patients with definite LB, the outcome was excellent or good in 49 (92.5%) AMOX-treated patients and 47 (87.0%) PBO patients and poor in 3 (5.7%) AMOX-treated patients and 6 (11.1%) PBO patients (difference nonsignificant, p = 0.49). Twelve months after the end of intravenous antibiotic therapy, the levels of antibodies against Borrelia burgdorferi were markedly decreased in 50% of the patients with definite LB in both groups. The results indicate that oral adjunct antibiotics are not justified in the treatment of patients with disseminated LB who initially receive intravenous CRO for 3 weeks. The clinical outcome cannot be evaluated at the completion of intravenous antibiotic treatment but rather 6?12 months afterwards. In patients with chronic post-treatment symptoms, persistent positive levels of antibodies do not seem to provide any useful information for further care of the patient.?
· Yrjänäinen H, Hytönen J, Song XRm Oksi J, Hartiala K, Viljanen MK. (2007). ?Anti-tumor necrosis factor-α treatment activates Borrelia burgdorferi spirochetes 4 weeks after ceftriaxone treatment in C3H/He mice�?. J Infect Dis 195: 1489-1496. [C]
http://www.journals.uchicago.edu/doi/abs/10.1086/513873
Background. The effect of anti-tumor necrosis factor (TNF)-α treatment in Borrelia burgdorferi-infected and ceftriaxone-treated C3H/He mice was evaluated.
Methods. Mice were infected with B. garinii Å218 or B. burgdorferi sensu stricto N40. At 2 weeks of infection, one group was treated simultaneously with ceftriaxone and anti-TNF-α, whereas another received ceftriaxone at 2 weeks and anti-TNF-α 4 weeks later. One group received ceftriaxone treatment only. Infected and noninfected control groups were sham treated.
Results. At 14 weeks of infection, B. burgdorferi could not be detected by cultivation or by polymerase chain reaction in tissue samples of any mouse treated with ceftriaxone only. However, spirochetes grew from the tissue samples of one-third of the mice treated with anti-TNF-α simultaneously or 4 weeks after ceftriaxone. These activated spirochetes showed ceftriaxone sensitivity rates, plasmid profiles, and virulence rates similar to those of bacteria used to infect the mice. All infected control mice and mice given anti-TNF-α only were culture positive.
Conclusions. This report shows that, after ceftriaxone treatment for 5 days, a portion of B. burgdorferi-infected mice still have live spirochetes in their body, which are activated by anti-TNF-α treatment.
· Yrjänäinen, H., Hytönen, J., Söderström, K.-O., Oksi, J., Hartiala, K., Viljanen, M.K. (2006). "Persistent joint swelling and borrelia-specific antibodies in Borrelia garinii-infected mice after eradication of vegetative spirochetes with antibiotic treatment." Microbes and Infection 8: 2044-51. [C]
http://www.ncbi.nlm.nih.gov/pubmed/16797205
?We wanted to study the pathogenesis and the long-term manifestations of Borrelia garinii infection in SJL and C3H/He mice. We report here that B. garinii A218 causes a persisting infection in these mouse strains. Mice infected with intracutaneous inoculation of B. garinii at 4-5 weeks of age developed a disseminated infection and joint swelling within 2 weeks of inoculation and remained infected with joint symptoms until the end of follow-ups of up to 52 weeks. Treatment with ceftriaxone or ampicillin at 18 or 44 weeks of infection did not affect the joint swelling during the follow-ups of 19 and 8 weeks, respectively. However, B. garinii could not be cultured from any of the post mortem tissue samples of the treated mice, whereas the spirochete grew from samples of all untreated infected animals. Borrelia-specific IgG antibodies were detectable after 2 weeks of infection, and in late infection, all mice had high anti-borrelia IgG levels. Antibiotic treatment had no effect on antibody levels. Histology showed only slight changes in the joints of the infected mice with occasional lymphocyte infiltration, synovial proliferation and slight involvement of the Achilles' tendon. No difference was seen in the findings between ceftriaxone-treated and untreated mice. The results suggest that the presence of vegetative spirochetes is no prerequisite for persisting joint symptoms and elevated anti-borrelia IgG levels in these B. garinii-infected mice.?
Oksin ym tutkimus v. 1996: "Borreliabakteerin aiheuttamia tulehduksellisia aivomuutoksia." Kolmelta potilaalta otettiin aivoista koepala ja niissä jokaisella todettiin mm. verisuonitulehdus. Yhdellä potilaalla esiintyi laaja valkean aineen muutos - potilas menehtyi. Yhdellä lapsella ilmeni toispuolinen halvaus ja 40-vuotiaalla miehellä epileptisiä kohtauksia. Miehen tila parani useiden antibioottikuurien jälkeen. Tutkimuksessa todettiin borreliabakteerin voivan aiheuttaa aivotulehduksia ja verisuonitulehduksia.
Brain, Vol. 119, No. 6, 2143-2154, 1996
© 1996 Guarantors of Brain
--------------------------------------------------------------------------------
research-article
Inflammatory brain changes in Lyme borreliosis
A report on three patients and review of literature
J. Oksi1,5,7, H. Kalimo2, R. J. Marttila3 , M. Marjamaki2, P. Sonninen4, J. Nikoskelainen1 and M. K. Viljanen6,7
1Departments of Internal MedicineTurku University Central Hospital Turku, Finland 2Departments of Pathology, Turku University Central Hospital Turku, Finland 3Departments of Neurology, Turku University Central Hospital Turku, Finland 4Departments of Radiology, Turku University Central Hospital Turku, Finland 5Department of Medical Microbiology, Turku University Turku, Finland 6National Public Health Institute, Department in Turku Turku, Finland 7Turku Immunology Centre Turku, Finland
Correspondence to: Correspondence to: J. Oksi, Turku University, Department of Medical Microbiology, Kiinamyllynkatu 13, FIN-20520 Turku, Finland
Despite a rapid increase in the number of patients with Lyme neuroborreliosis (LNB), its neuropathological aspects are poorly understood. The objective of this study was evaluation of neuropathological, microbiological, and magnetic resonance imaging (MRI) findings in three patients with the Borrelia burgdorferi infection and neurological disease from whom brain tissue specimens were available. Perivascular or vasculitic lymphocytic inflammation was detected in all specimens. Large areas of demyelination in periventricular white matter were detected histologically and by MRI in one patient. The disease had a fatal outcome in this patient. Brain MRI suggested malignancies in two patients before histopathological studies were carried out. One of these two patients was a child with sudden hemiparesis. Another was a 40-year-old man presenting with epileptic seizures and MRI-detected multifocal lesions, which disappeared after repeated courses of antibiotics. We conclude that cerebral lymphocytic vasculitis and multifocal encephalitis may be associated with B. burgdorferi infection. The presence of B. burgdorferi DNA in tissue samples from areas with inflammatory changes indicates that direct invasion of B. burgdorferi may be the pathogenetic mechanism for focal encephalitis in LNB.
Borrelia burgdorferi; Lyme disease; neuroborreliosis; neuropathology; vasculitis
Received April 30, 1996. Revised June 4, 1996. Accepted July 25, 1996.
Brain, Vol. 119, No. 6, 2143-2154, 1996
© 1996 Guarantors of Brain
--------------------------------------------------------------------------------
research-article
Inflammatory brain changes in Lyme borreliosis
A report on three patients and review of literature
J. Oksi1,5,7, H. Kalimo2, R. J. Marttila3 , M. Marjamaki2, P. Sonninen4, J. Nikoskelainen1 and M. K. Viljanen6,7
1Departments of Internal MedicineTurku University Central Hospital Turku, Finland 2Departments of Pathology, Turku University Central Hospital Turku, Finland 3Departments of Neurology, Turku University Central Hospital Turku, Finland 4Departments of Radiology, Turku University Central Hospital Turku, Finland 5Department of Medical Microbiology, Turku University Turku, Finland 6National Public Health Institute, Department in Turku Turku, Finland 7Turku Immunology Centre Turku, Finland
Correspondence to: Correspondence to: J. Oksi, Turku University, Department of Medical Microbiology, Kiinamyllynkatu 13, FIN-20520 Turku, Finland
Despite a rapid increase in the number of patients with Lyme neuroborreliosis (LNB), its neuropathological aspects are poorly understood. The objective of this study was evaluation of neuropathological, microbiological, and magnetic resonance imaging (MRI) findings in three patients with the Borrelia burgdorferi infection and neurological disease from whom brain tissue specimens were available. Perivascular or vasculitic lymphocytic inflammation was detected in all specimens. Large areas of demyelination in periventricular white matter were detected histologically and by MRI in one patient. The disease had a fatal outcome in this patient. Brain MRI suggested malignancies in two patients before histopathological studies were carried out. One of these two patients was a child with sudden hemiparesis. Another was a 40-year-old man presenting with epileptic seizures and MRI-detected multifocal lesions, which disappeared after repeated courses of antibiotics. We conclude that cerebral lymphocytic vasculitis and multifocal encephalitis may be associated with B. burgdorferi infection. The presence of B. burgdorferi DNA in tissue samples from areas with inflammatory changes indicates that direct invasion of B. burgdorferi may be the pathogenetic mechanism for focal encephalitis in LNB.
Borrelia burgdorferi; Lyme disease; neuroborreliosis; neuropathology; vasculitis
Received April 30, 1996. Revised June 4, 1996. Accepted July 25, 1996.
47-vuotias tanskalainen nainen sairastui neuroborrelioosiin. Sai 10 viikon iv antibioottihoidot. Oireet hävisivät mutta palasivat 9 kk:n kuluttua. Uusi infektio vai taudin aktivoituminen uudelleen?
Neuroborreliosis recurrence: Reinfection or relapse?
Authors: Niels V. Krabbe a; Tove Ejlertsen a; Henrik Nielsen a
Affiliation: a From the Departments of Infectious Diseases and Clinical Microbiology, Aalborg Hospital, Aarhus University Hospital, Aalborg, Denmark
DOI: 10.1080/00365540802372254
Publication Frequency: 12 issues per year
Published in: Scandinavian Journal of Infectious Diseases
First Published on: 21 August 2008
Subject: Infectious Diseases;
Formats available: HTML (English) : PDF (English)
Article Requests: Order Reprints : Request Permissions
Purchase Article: ?28.00 plus VAT - buy now add to cart
Sign In
Online Sample
Abstract
We report the case of a 47-y-old female with documented neuroborreliosis, who had a complete recovery after 10 d of intravenous high-dose penicillin followed after 9 months by a new episode of documented neuroborreliosis. The case probably represents a rare case of true reinfection rather than relapse.
Neuroborreliosis recurrence: Reinfection or relapse?
Authors: Niels V. Krabbe a; Tove Ejlertsen a; Henrik Nielsen a
Affiliation: a From the Departments of Infectious Diseases and Clinical Microbiology, Aalborg Hospital, Aarhus University Hospital, Aalborg, Denmark
DOI: 10.1080/00365540802372254
Publication Frequency: 12 issues per year
Published in: Scandinavian Journal of Infectious Diseases
First Published on: 21 August 2008
Subject: Infectious Diseases;
Formats available: HTML (English) : PDF (English)
Article Requests: Order Reprints : Request Permissions
Purchase Article: ?28.00 plus VAT - buy now add to cart
Sign In
Online Sample
Abstract
We report the case of a 47-y-old female with documented neuroborreliosis, who had a complete recovery after 10 d of intravenous high-dose penicillin followed after 9 months by a new episode of documented neuroborreliosis. The case probably represents a rare case of true reinfection rather than relapse.
"Kroonisella borrelioosilla tarkoitetaan oireiden jatkumista perinteisen 2 - 4 viikon antibioottihoidon jälkeen. Tri A. L. Hasset ym. tutkivat 77 kroonista borrelioosia sairastavaa ja 82 ei-kroonista borrelioosia sairastavaa: Kroonista borrelioosia sairastavilla esiintyi esim. masennusta ja fibromyalgiatyyppisiä kipuja. Verrokkiryhmän potilaat olivat joko parantuneet borrelioosista tai heidän oireilleen löydettiin jokin muu syy kuin borreliabakteeri."
(Suom. huom. Millä menetelmällä poissulkivat borreliabakteerin mahdollisuuuden verrokkiryhmällä? Sellaista testiä ei ole vielä tällä hetkellä olemassa).
By Megan Rauscher
NEW YORK (Reuters Health) - Depression and the chronic pain syndrome fibromyalgia are common in patients who suffer from chronic Lyme disease and seem to correlate with poor functional outcomes, results of a study indicate.
The term chronic Lyme disease describes patients with persistent Lyme disease despite prior treatment with a conventional 2- to 4-week course of antibiotics.
Dr. Afton L. Hassett from the University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick and colleagues studied 159 patients seen at an academic Lyme disease referral center.
They evaluated the prevalence and role of psychiatric "co-morbid" illness and psychological factors in 77 patients with chronic Lyme disease and 82 (comparison) patients without chronic Lyme disease. The comparison patients either recovered from Lyme disease or had Lyme-like symptoms explained by other conditions.
(Suom. huom. Millä menetelmällä poissulkivat borreliabakteerin mahdollisuuuden verrokkiryhmällä? Sellaista testiä ei ole vielä tällä hetkellä olemassa).
By Megan Rauscher
NEW YORK (Reuters Health) - Depression and the chronic pain syndrome fibromyalgia are common in patients who suffer from chronic Lyme disease and seem to correlate with poor functional outcomes, results of a study indicate.
The term chronic Lyme disease describes patients with persistent Lyme disease despite prior treatment with a conventional 2- to 4-week course of antibiotics.
Dr. Afton L. Hassett from the University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick and colleagues studied 159 patients seen at an academic Lyme disease referral center.
They evaluated the prevalence and role of psychiatric "co-morbid" illness and psychological factors in 77 patients with chronic Lyme disease and 82 (comparison) patients without chronic Lyme disease. The comparison patients either recovered from Lyme disease or had Lyme-like symptoms explained by other conditions.
Kroonista borrelioosia sairastavilla esiintyi kontrolliryhmää enemmän psyykkisiä häiriöitä - ei kuitenkaan persoonallisuushäiriöitä - sekä suurempaa kipuherkkyyttä. Fibromyalgia diagnosoitiin melkein puolella tutkittavista borrelioosia sairastavista (46,8 %). Tutkimukseen osallistui 159 henkilöä.
Arthritis Rheum. 2008 Nov 26;59(12):1742-1749 [Epub ahead of print]
Role of psychiatric comorbidity in chronic Lyme disease.
Hassett AL, Radvanski DC, Buyske S, Savage SV, Gara M, Escobar JI, Sigal LH.
University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick.
OBJECTIVE: To evaluate the prevalence and role of psychiatric comorbidity and other psychological factors in patients with chronic Lyme disease (CLD).
METHODS: We assessed 159 patients drawn from a cohort of 240 patients evaluated at an academic Lyme disease referral center. Patients were screened for common axis I psychiatric disorders (e.g., depressive and anxiety disorders); structured clinical interviews confirmed diagnoses. Axis II personality disorders, functional status, and traits like negative and positive affect and pain catastrophizing were also evaluated. A physician blind to psychiatric assessment results performed a medical evaluation. Two groups of CLD patients (those with post-Lyme disease syndrome and those with medically unexplained symptoms attributed to Lyme disease but without Borrelia burgdorferi infection) were compared with 2 groups of patients without CLD (patients recovered from Lyme disease and those with an identifiable medical condition explaining symptoms attributed to Lyme disease).
RESULTS: After adjusting for age and sex, axis I psychiatric disorders were more common in CLD patients than in comparison patients (P = 0.02, odds ratio 2.64, 95% confidence interval 1.30-5.35), but personality disorders were not. Patients with CLD had higher negative affect, lower positive affect, and a greater tendency to catastrophize pain (P < 0.001) than comparison patients. All psychological factors except personality disorders were related to level of functioning. A predictive model based on these psychological variables was confirmed. Fibromyalgia was diagnosed in 46.8% of CLD patients.
CONCLUSION: Psychiatric comorbidity and other psychological factors distinguished CLD patients from other patients commonly seen in Lyme disease referral centers, and were related to poor functional outcomes.
PMID: 19035409 [PubMed - as supplied by publisher]
Arthritis Rheum. 2008 Nov 26;59(12):1742-1749 [Epub ahead of print]
Role of psychiatric comorbidity in chronic Lyme disease.
Hassett AL, Radvanski DC, Buyske S, Savage SV, Gara M, Escobar JI, Sigal LH.
University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick.
OBJECTIVE: To evaluate the prevalence and role of psychiatric comorbidity and other psychological factors in patients with chronic Lyme disease (CLD).
METHODS: We assessed 159 patients drawn from a cohort of 240 patients evaluated at an academic Lyme disease referral center. Patients were screened for common axis I psychiatric disorders (e.g., depressive and anxiety disorders); structured clinical interviews confirmed diagnoses. Axis II personality disorders, functional status, and traits like negative and positive affect and pain catastrophizing were also evaluated. A physician blind to psychiatric assessment results performed a medical evaluation. Two groups of CLD patients (those with post-Lyme disease syndrome and those with medically unexplained symptoms attributed to Lyme disease but without Borrelia burgdorferi infection) were compared with 2 groups of patients without CLD (patients recovered from Lyme disease and those with an identifiable medical condition explaining symptoms attributed to Lyme disease).
RESULTS: After adjusting for age and sex, axis I psychiatric disorders were more common in CLD patients than in comparison patients (P = 0.02, odds ratio 2.64, 95% confidence interval 1.30-5.35), but personality disorders were not. Patients with CLD had higher negative affect, lower positive affect, and a greater tendency to catastrophize pain (P < 0.001) than comparison patients. All psychological factors except personality disorders were related to level of functioning. A predictive model based on these psychological variables was confirmed. Fibromyalgia was diagnosed in 46.8% of CLD patients.
CONCLUSION: Psychiatric comorbidity and other psychological factors distinguished CLD patients from other patients commonly seen in Lyme disease referral centers, and were related to poor functional outcomes.
PMID: 19035409 [PubMed - as supplied by publisher]
Tutkimusten mukaan varhaisvaiheen borrelioosissa C3 ja C4 ovat usein koholla. Allaolevan tutkimuksen mukaan kroonisessa borrelioosissa sen sijaan esiintyy C4:n kohoamista.
Ps. Onko keneltäkään koskaan otettu C4-testiä? Kertokaa mitä testitulokset osoittivat.
Complement Split Products C3a and C4a in Chronic Lyme Disease
Authors: Stricker, R. B.; Savely, V. R.; Motanya, N. C.1; Giclas, P. C.2
Source: Scandinavian Journal of Immunology, Volume 69, Number 1, January 2009 , pp. 64-69(6)
Abstract:
Complement split products C3a and C4a are reportedly elevated in patients with acute Lyme disease. We have now examined these immunologic markers in patients with chronic Lyme disease compared to appropriate disease controls.
The study population consisted of 29 healthy controls, 445 patients with chronic Lyme disease, 11 patients with systemic lupus erythematosus (SLE) and six patients with AIDS. The Lyme disease patients were divided according to predominant musculoskeletal symptoms (324 patients) or predominant neurologic symptoms (121 patients). C3a and C4a levels were measured by radioimmunoassay. All patients with chronic Lyme disease and AIDS had normal C3a levels compared to controls, whereas patients with SLE had significantly increased levels of this marker. Patients with predominant musculoskeletal symptoms of Lyme disease and AIDS patients had significantly increased levels of C4a compared to either controls, patients with predominant neurologic symptoms of Lyme disease or SLE patients. Response to antibiotic therapy in chronic Lyme disease was associated with a significant decrease in the C4a level, whereas lack of response was associated with a significant increase in this marker. In contrast, AIDS patients had persistently increased C4a levels despite antiretroviral therapy. Lyme patients with positive single-photon emission computed tomographic (SPECT) scans had significantly lower C4a levels compared to Lyme patients with normal SPECT scan results. Patients with predominant musculoskeletal symptoms of Lyme disease have normal C3a and increased C4a levels. This pattern differs from the increase in both markers seen in acute Lyme disease, and C4a changes correlate with the response to therapy in chronic Lyme disease. C4a appears to be a valuable immunologic marker in patients with persistent symptoms of Lyme disease.
Document Type: Research article
DOI: 10.1111/j.1365-3083.2008.02191.x
Affiliations: 1: Union Square Medical Associates, San Francisco, CA, USA 2:
Allergy and Immunology Division, Department of Pediatrics, National Jewish
Medical and Research Center, Denver, CO, USA
The full text electronic article is available for purchase. You will be
able to download the full text electronic article after payment.
$43.08 plus tax
Ps. Onko keneltäkään koskaan otettu C4-testiä? Kertokaa mitä testitulokset osoittivat.
Complement Split Products C3a and C4a in Chronic Lyme Disease
Authors: Stricker, R. B.; Savely, V. R.; Motanya, N. C.1; Giclas, P. C.2
Source: Scandinavian Journal of Immunology, Volume 69, Number 1, January 2009 , pp. 64-69(6)
Abstract:
Complement split products C3a and C4a are reportedly elevated in patients with acute Lyme disease. We have now examined these immunologic markers in patients with chronic Lyme disease compared to appropriate disease controls.
The study population consisted of 29 healthy controls, 445 patients with chronic Lyme disease, 11 patients with systemic lupus erythematosus (SLE) and six patients with AIDS. The Lyme disease patients were divided according to predominant musculoskeletal symptoms (324 patients) or predominant neurologic symptoms (121 patients). C3a and C4a levels were measured by radioimmunoassay. All patients with chronic Lyme disease and AIDS had normal C3a levels compared to controls, whereas patients with SLE had significantly increased levels of this marker. Patients with predominant musculoskeletal symptoms of Lyme disease and AIDS patients had significantly increased levels of C4a compared to either controls, patients with predominant neurologic symptoms of Lyme disease or SLE patients. Response to antibiotic therapy in chronic Lyme disease was associated with a significant decrease in the C4a level, whereas lack of response was associated with a significant increase in this marker. In contrast, AIDS patients had persistently increased C4a levels despite antiretroviral therapy. Lyme patients with positive single-photon emission computed tomographic (SPECT) scans had significantly lower C4a levels compared to Lyme patients with normal SPECT scan results. Patients with predominant musculoskeletal symptoms of Lyme disease have normal C3a and increased C4a levels. This pattern differs from the increase in both markers seen in acute Lyme disease, and C4a changes correlate with the response to therapy in chronic Lyme disease. C4a appears to be a valuable immunologic marker in patients with persistent symptoms of Lyme disease.
Document Type: Research article
DOI: 10.1111/j.1365-3083.2008.02191.x
Affiliations: 1: Union Square Medical Associates, San Francisco, CA, USA 2:
Allergy and Immunology Division, Department of Pediatrics, National Jewish
Medical and Research Center, Denver, CO, USA
The full text electronic article is available for purchase. You will be
able to download the full text electronic article after payment.
$43.08 plus tax
Weintraub kertoo borrelioosikirjassaan (s. 342 - 344) Stonybrookin tutkijan Gan Quin näkemyksen jonka mukaan borrelioosista on olemassa kahdenlaista taudinkuvaa riippuen siitä minkätyyppinen bakteeri taudin on aiheuttanut.
1. Lyhytkestoinen taudinkulku. Bakteeri lisääntyy kloonaamalla. Aiheuttaa ihomuutoksen. Paranee lyhytkestoisella antibioottihoidolla.
2. Krooninen taudinkulku. Bakteeri leviää eri puolille elimistöä esim. luustoon, aivoihin jne. Bakteeri lisääntyy suvullisesti.
Esim. USA:n itärannikolta löydetyistä 20 bakteerikannasta 10 ei näyttäisi aiheuttavan sairautta, 6 aiheuttaa lyhytaikaisen taudinkulun ja 4 on erittäin virulentteja aiheuttaen kroonisen taudinkulun. Tätä kantaa, B 31, esiintyy yleisesti Euroopassa ja USA:ssa. Tästä syystä borrelioosin hoidossa erilaiset hoitoprotokollat ovat välttämättömiä.
"As documented in pages 342 - 344 of P. Weintraub's book, based on recent research by Stonybrook researcher Gan Qui, there appear to be two different types of disease caused by two different acting organisms.
The first is a short term disease which manifests a skin rash, divides by cloning, and is a fairly short cure. The second is a chronic disease, spreads throughout the body, disseminates into organs, brain and bone, and is differentiated from the first by division by sexual reproduction, utilizing genetic exchange.
Of the TWENTY strains recently found on the East Coast of the continental USA by Qui, there appear to be 10 strains which do not cause disease, and six strains which cause only a rash, indicating a short=term, easily cured disease picture.
However, researchers found four strains of the long term and invasive disease - the most virulent of the chronic strains apparently the B-31, originally found in Block Island and currently found widespread in Europe and the USA.
This research supports the long-held ideas that Lyme disease can be a chronic, disseminated disease requiring longer term treatment.
Although more work needs to be done in this area of differentiating between the two subsets of disease, for now, physicians need to be aware that there are two distinct subsets of Lyme disease with very different presentations, therefore, a wide range of treatment is appropriate and should not be artificially limited by academic physicians who are unaware of the most recent research on disease strains."
1. Lyhytkestoinen taudinkulku. Bakteeri lisääntyy kloonaamalla. Aiheuttaa ihomuutoksen. Paranee lyhytkestoisella antibioottihoidolla.
2. Krooninen taudinkulku. Bakteeri leviää eri puolille elimistöä esim. luustoon, aivoihin jne. Bakteeri lisääntyy suvullisesti.
Esim. USA:n itärannikolta löydetyistä 20 bakteerikannasta 10 ei näyttäisi aiheuttavan sairautta, 6 aiheuttaa lyhytaikaisen taudinkulun ja 4 on erittäin virulentteja aiheuttaen kroonisen taudinkulun. Tätä kantaa, B 31, esiintyy yleisesti Euroopassa ja USA:ssa. Tästä syystä borrelioosin hoidossa erilaiset hoitoprotokollat ovat välttämättömiä.
"As documented in pages 342 - 344 of P. Weintraub's book, based on recent research by Stonybrook researcher Gan Qui, there appear to be two different types of disease caused by two different acting organisms.
The first is a short term disease which manifests a skin rash, divides by cloning, and is a fairly short cure. The second is a chronic disease, spreads throughout the body, disseminates into organs, brain and bone, and is differentiated from the first by division by sexual reproduction, utilizing genetic exchange.
Of the TWENTY strains recently found on the East Coast of the continental USA by Qui, there appear to be 10 strains which do not cause disease, and six strains which cause only a rash, indicating a short=term, easily cured disease picture.
However, researchers found four strains of the long term and invasive disease - the most virulent of the chronic strains apparently the B-31, originally found in Block Island and currently found widespread in Europe and the USA.
This research supports the long-held ideas that Lyme disease can be a chronic, disseminated disease requiring longer term treatment.
Although more work needs to be done in this area of differentiating between the two subsets of disease, for now, physicians need to be aware that there are two distinct subsets of Lyme disease with very different presentations, therefore, a wide range of treatment is appropriate and should not be artificially limited by academic physicians who are unaware of the most recent research on disease strains."
Kroonista borrelioosia sairastavalta löytyi borreliabakteereita jänteistä. Bakteerit tutkittiin elektronimikroskooppisella tutkimuksella. (Saksa)
Persistence of Borrelia burgdorferi in ligamentous tissue from a patient with chronic Lyme borreliosis.
Haupl T, Hahn G, Rittig M, Krause A, Schoerner C, Schonherr U, Kalden JR, Burmester GR.
Department of Medicine III, University of Erlangen-Nuremberg, Germany.
OBJECTIVE. To document the persistence of Borrelia burgdorferi in ligamentous tissue samples obtained from a woman with chronic Lyme borreliosis.
METHODS. Spirochetes were isolated from samples of ligamentous tissue, and the spirochetes were characterized antigenetically and by molecular biology techniques. The ligamentous tissue was examined by electron microscopy. Humoral and cellular immune responses were analyzed.
RESULTS. Choroiditis was the first recognized manifestation of Lyme disease in this patient. Despite antibiotic therapy, there was progression to a chronic stage, with multisystem manifestations. The initially significant immune system activation was followed by a loss of the specific humoral immune response and a decrease in the cellular immune response to B burgdorferi over the course of the disease. "Trigger finger" developed, and a portion of the flexor retinaculum obtained at surgery was cultured. Viable spirochetes were identified. Ultramorphologically, the spirochetes were situated between collagen fibers and along fibroblasts, some of which were deeply invaginated by these organisms. The cultured bacteria were identified as B burgdorferi by reactions with specific immune sera and monoclonal antibodies, and by polymerase chain reaction amplification and Southern blot hybridization
techniques.
CONCLUSION. To our knowledge, this is the first report of the isolation of B burgdorferi from ligamentous tissue. This suggests that tendon tissues serve as a specific site of spirochete residence in human hosts. PMID: 8240439 [PubMed - indexed for MEDLINE
Persistence of Borrelia burgdorferi in ligamentous tissue from a patient with chronic Lyme borreliosis.
Haupl T, Hahn G, Rittig M, Krause A, Schoerner C, Schonherr U, Kalden JR, Burmester GR.
Department of Medicine III, University of Erlangen-Nuremberg, Germany.
OBJECTIVE. To document the persistence of Borrelia burgdorferi in ligamentous tissue samples obtained from a woman with chronic Lyme borreliosis.
METHODS. Spirochetes were isolated from samples of ligamentous tissue, and the spirochetes were characterized antigenetically and by molecular biology techniques. The ligamentous tissue was examined by electron microscopy. Humoral and cellular immune responses were analyzed.
RESULTS. Choroiditis was the first recognized manifestation of Lyme disease in this patient. Despite antibiotic therapy, there was progression to a chronic stage, with multisystem manifestations. The initially significant immune system activation was followed by a loss of the specific humoral immune response and a decrease in the cellular immune response to B burgdorferi over the course of the disease. "Trigger finger" developed, and a portion of the flexor retinaculum obtained at surgery was cultured. Viable spirochetes were identified. Ultramorphologically, the spirochetes were situated between collagen fibers and along fibroblasts, some of which were deeply invaginated by these organisms. The cultured bacteria were identified as B burgdorferi by reactions with specific immune sera and monoclonal antibodies, and by polymerase chain reaction amplification and Southern blot hybridization
techniques.
CONCLUSION. To our knowledge, this is the first report of the isolation of B burgdorferi from ligamentous tissue. This suggests that tendon tissues serve as a specific site of spirochete residence in human hosts. PMID: 8240439 [PubMed - indexed for MEDLINE
Neuroborrelioosia sairastavista 36,7 %:lla, iho-oireisista 17,6 %:lla ja niveloireisista 54,5 %:lla löydettiin hoitojen jälkeenkin borreliabakteerin DNA:ta PCR-menetelmällä tutkittuna. (Tsekki)
Int J Dermatol. 2008 Oct;47(10):1004-10.
Examination of specific DNA by PCR in patients with different forms of Lymeborreliosis.
Picha D, Moravcova L, Holeckova D, Zd'arsky E, Valesova M, Maresova V, HercogovaJ, Vanousova D. Charles University, 2nd Medical School, 1st Clinic for Infectious Diseases,Teaching Hospital Bulovka, Prague, Czech Republic. dusan.picha@fnb.cz
BACKGROUND: Borrelial specific DNA was examined in a group of 62 patients withdifferent forms of Lyme borreliosis (LB) (32 patients suffered fromneuroborreliosis, 19 manifested erythema migrans, and 11 joint involvement).
METHODS: Nested-PCR system with five newly derived primers was used in parallel.The study was organized prospectively, the presence of DNA was tested forplasma, CSF, joint fluid and urine before treatment, and plasma, joint fluid andurine were examined after treatment.
RESULTS: Before therapy, 36 patients(58.1%) were DNA positive on the whole; 21 positive patients (65.6%) were foundin the group of neuroborreliosis, 8 (42.1%) showed signs of skin involvement,and 7 (63.6%) were positive in arthritis. After treatment, 11 patients (36.7%)were positive in neuroborreliosis, 3 (17.6%) in skin form, and 6 (54.5%) injoint form of LB. Among 97 positive amplifications the most frequent target wasfound in primer corresponding with 16S rDNA (50 samples, 51.5%). Lower but verysimilar results were obtained with primers for OspA (18 positive amplifications;18.6%), OspC (13 positive amplifications; 13.4%), and flagellin (13 positiveamplifications; 13.4%). There were 11 patients in whom only DNA and no specificantibodies were found.
CONCLUSIONS: Specific DNA was found in all clinicalgroups of LB with similar sensitivity. Examination of the borrelial DNA in urinedisplayed the same sensitivity as in CSF and had a two times higher sensitivitythan in plasma. Publication Types:Research Support, Non-U.S. Gov't PMID: 18986344 [PubMed - in process]
Int J Dermatol. 2008 Oct;47(10):1004-10.
Examination of specific DNA by PCR in patients with different forms of Lymeborreliosis.
Picha D, Moravcova L, Holeckova D, Zd'arsky E, Valesova M, Maresova V, HercogovaJ, Vanousova D. Charles University, 2nd Medical School, 1st Clinic for Infectious Diseases,Teaching Hospital Bulovka, Prague, Czech Republic. dusan.picha@fnb.cz
BACKGROUND: Borrelial specific DNA was examined in a group of 62 patients withdifferent forms of Lyme borreliosis (LB) (32 patients suffered fromneuroborreliosis, 19 manifested erythema migrans, and 11 joint involvement).
METHODS: Nested-PCR system with five newly derived primers was used in parallel.The study was organized prospectively, the presence of DNA was tested forplasma, CSF, joint fluid and urine before treatment, and plasma, joint fluid andurine were examined after treatment.
RESULTS: Before therapy, 36 patients(58.1%) were DNA positive on the whole; 21 positive patients (65.6%) were foundin the group of neuroborreliosis, 8 (42.1%) showed signs of skin involvement,and 7 (63.6%) were positive in arthritis. After treatment, 11 patients (36.7%)were positive in neuroborreliosis, 3 (17.6%) in skin form, and 6 (54.5%) injoint form of LB. Among 97 positive amplifications the most frequent target wasfound in primer corresponding with 16S rDNA (50 samples, 51.5%). Lower but verysimilar results were obtained with primers for OspA (18 positive amplifications;18.6%), OspC (13 positive amplifications; 13.4%), and flagellin (13 positiveamplifications; 13.4%). There were 11 patients in whom only DNA and no specificantibodies were found.
CONCLUSIONS: Specific DNA was found in all clinicalgroups of LB with similar sensitivity. Examination of the borrelial DNA in urinedisplayed the same sensitivity as in CSF and had a two times higher sensitivitythan in plasma. Publication Types:Research Support, Non-U.S. Gov't PMID: 18986344 [PubMed - in process]
Luonnolliset T-tappajasolut ovat merkittävässä asemassa borreliabakteerin hävittämisestä elimistöstä ja kroonisten niveltulehdusten estämisessä. Nimenomaan humoraalinen immuniteetti on ensisijaisessa asemassa.
Proc Natl Acad Sci U S A. 2008 Dec 5; [Epub ahead of print]
NKT cells prevent chronic joint inflammation after infection with Borreliaburgdorferi.
Tupin E, Benhnia MR, Kinjo Y, Patsey R, Lena CJ, Haller MC, Caimano MJ, ImamuraM, Wong CH, Crotty S, Radolf JD, Sellati TJ, Kronenberg M. Divisions of Developmental Immunology and.
Borrelia burgdorferi is the etiologic agent of Lyme disease, a multisysteminflammatory disorder that principally targets the skin, joints, heart, andnervous system. The role of T lymphocytes in the development of chronicinflammation resulting from B. burgdorferi infection has been controversial. Wepreviously showed that natural killer T (NKT) cells with an invariant (i) TCRalpha chain (iNKT cells) recognize glycolipids from B. burgdorferi, but did notestablish an in vivo role for iNKT cells in Lyme disease pathogenesis. Here, weevaluate the importance of iNKT cells for host defense against these pathogenicspirochetes by using Valpha14i NKT cell-deficient (Jalpha18(-/-)) BALB/c mice.On tick inoculation with B. burgdorferi, Jalpha18(-/-) mice exhibited moresevere and prolonged arthritis as well as a reduced ability to clear spirochetesfrom infected tissues. Valpha14i NKT cell deficiency also resulted in increasedproduction of antibodies directed against both B. burgdorferi protein antigensand borrelial diacylglycerols; the latter finding demonstrates thatanti-glycolipid antibody production does not require cognate help from Valpha14iNKT cells. Valpha14i NKT cells in infected wild-type mice expressed surfaceactivation markers and produced IFNgamma in vivo after infection, suggesting aparticipatory role for this unique population in cellular immunity.
Our data areconsistent with the hypothesis that the antigen-specific activation of Valpha14iNKT cells is important for the prevention of persistent joint inflammation andspirochete clearance, and they counter the long-standing notion that humoralrather than cellular immunity is sufficient to facilitate Lyme diseaseresolution.
PMID: 19060201 [PubMed - as supplied by publisher]
Proc Natl Acad Sci U S A. 2008 Dec 5; [Epub ahead of print]
NKT cells prevent chronic joint inflammation after infection with Borreliaburgdorferi.
Tupin E, Benhnia MR, Kinjo Y, Patsey R, Lena CJ, Haller MC, Caimano MJ, ImamuraM, Wong CH, Crotty S, Radolf JD, Sellati TJ, Kronenberg M. Divisions of Developmental Immunology and.
Borrelia burgdorferi is the etiologic agent of Lyme disease, a multisysteminflammatory disorder that principally targets the skin, joints, heart, andnervous system. The role of T lymphocytes in the development of chronicinflammation resulting from B. burgdorferi infection has been controversial. Wepreviously showed that natural killer T (NKT) cells with an invariant (i) TCRalpha chain (iNKT cells) recognize glycolipids from B. burgdorferi, but did notestablish an in vivo role for iNKT cells in Lyme disease pathogenesis. Here, weevaluate the importance of iNKT cells for host defense against these pathogenicspirochetes by using Valpha14i NKT cell-deficient (Jalpha18(-/-)) BALB/c mice.On tick inoculation with B. burgdorferi, Jalpha18(-/-) mice exhibited moresevere and prolonged arthritis as well as a reduced ability to clear spirochetesfrom infected tissues. Valpha14i NKT cell deficiency also resulted in increasedproduction of antibodies directed against both B. burgdorferi protein antigensand borrelial diacylglycerols; the latter finding demonstrates thatanti-glycolipid antibody production does not require cognate help from Valpha14iNKT cells. Valpha14i NKT cells in infected wild-type mice expressed surfaceactivation markers and produced IFNgamma in vivo after infection, suggesting aparticipatory role for this unique population in cellular immunity.
Our data areconsistent with the hypothesis that the antigen-specific activation of Valpha14iNKT cells is important for the prevention of persistent joint inflammation andspirochete clearance, and they counter the long-standing notion that humoralrather than cellular immunity is sufficient to facilitate Lyme diseaseresolution.
PMID: 19060201 [PubMed - as supplied by publisher]
Puola 2009: "Borrelioosi on borreliabakteeri (spirokeetta) B.burgdorferin aiheuttama krooninen sairaus. Sairaus ilmenee useimmiten ihossa, keskushermostossa, luustossa ja verenkierrossa. Oireet voivat jatkua vuosikausia esim. fatiikki, luusto-/lihaskivut, muisti-/keskittymisongelmat jne. Serologiset testit ovat usein negatiiviset. Syynmukaista hoitoa eim ole olemassa. Oireita hoidetaan esim. kipu-/masennus-/tulehdusta estävillä lääkkeillä.
Pol Merkur Lekarski. 2009 Mar;26(153):227-30. [Post Lyme syndrome as a clinical problem] [Article in Polish] Moniuszko A, Czupryna P, Zajkowska J, Pancewicz SA, Grygorczuk S, Kondrusik M. Department of Infectious Diseases and Neuroinfections, Medical University ofBialystok, Poland. annamoniuszko@op.pl
Lyme disease is a chronic tick borne disease, caused by spirochetes B.burgdorferi. The condition influences mostly on skin, nervous system, skeletalsystem and circulatory system. Recently more and more reports of so called "PostLyme syndrome (PLS)" have appeared. PLS is a new clinical, diagnostic andtherapeutic problem connected with patients with a history of Lyme disease (withproper antibiotic treatment). The symptoms of Post Lyme Syndrome may be presentthroughout months or even years. These are: fatigue, widespread musculoskeletalpain, dysmnesia, concentration difficulties. Pathogenesis of PLS is unknown. Itis suspected that main factors responsible for PLS are: slow regression ofinfection, its turning into chronic process and permanent destruction of tissuesor induction of immunological response against B. burgdorferi. Diagnostic of PLSis difficult. Mostly results of serological examination are negative. In somecases antibodies titer is positive as a sign of past disease. So far there is nocausative treatment of PLS. Antidepressants, painkillers and anti-inflammatorymedicines are recommended.
Publication Types:English Abstract PMID: 19388538 [PubMed - in process][/b]
Pol Merkur Lekarski. 2009 Mar;26(153):227-30. [Post Lyme syndrome as a clinical problem] [Article in Polish] Moniuszko A, Czupryna P, Zajkowska J, Pancewicz SA, Grygorczuk S, Kondrusik M. Department of Infectious Diseases and Neuroinfections, Medical University ofBialystok, Poland. annamoniuszko@op.pl
Lyme disease is a chronic tick borne disease, caused by spirochetes B.burgdorferi. The condition influences mostly on skin, nervous system, skeletalsystem and circulatory system. Recently more and more reports of so called "PostLyme syndrome (PLS)" have appeared. PLS is a new clinical, diagnostic andtherapeutic problem connected with patients with a history of Lyme disease (withproper antibiotic treatment). The symptoms of Post Lyme Syndrome may be presentthroughout months or even years. These are: fatigue, widespread musculoskeletalpain, dysmnesia, concentration difficulties. Pathogenesis of PLS is unknown. Itis suspected that main factors responsible for PLS are: slow regression ofinfection, its turning into chronic process and permanent destruction of tissuesor induction of immunological response against B. burgdorferi. Diagnostic of PLSis difficult. Mostly results of serological examination are negative. In somecases antibodies titer is positive as a sign of past disease. So far there is nocausative treatment of PLS. Antidepressants, painkillers and anti-inflammatorymedicines are recommended.
Publication Types:English Abstract PMID: 19388538 [PubMed - in process][/b]
USA 2009: Borreliabakteeri pystyy aiheuttamaan pysyvän, vuosikausia jatkuvan infektion tartunnan saaneessa. Bakteeria löydetään usein erilaisista tukikudoksista joissa se toimii esim. fibronektiinin kanssa.
Ps. Fibronektiini on glykoproteiini, jolla on spesifisiä vuorovaikutuksia solujen, kollageenien, bakteerien, fibriinin ja glykosaminoglykaanien kanssa... Fibronektiinillä on tärkeä merkitys solujen kiinnittymisessä, liikkeiden ohjailussa ja bakteerien fagosytoinnissa.
http://www.solunetti.fi/fi/solubiologia ... ektiini/2/
Infect Immun. 2009 Apr 27; [Epub ahead of print] The Borrelia burgdorferi RevA antigen binds host fibronectin. Brissette CA, Bykowski T, Cooley AE, Bowman A, Stevenson B. Department of Microbiology, Immunology, and Molecular Genetics, University ofKentucky.
Borrelia burgdorferi, the Lyme disease spirochete, can persistently infect itsvertebrate hosts for years. B. burgdorferi is often found associated with hostconnective tissue, where it interacts with components of the extracellularmatrix, including fibronectin. Some years ago, a borrelial surface protein,named BBK32, was identified as a fibronectin-binding protein. However, B.burgdorferi bbk32 mutants are still able to bind fibronectin, indicating thatthe spirochete possesses additional mechanisms for adherence to fibronectin. Wenow demonstrate that RevA, an unrelated B. burgdorferi outer surface protein,binds mammalian fibronectin in a saturable manner. Site-directed mutagenesisstudies identified the amino terminus of the RevA protein as being required inadhesion to fibronectin. RevA bound to the amino-terminal region of fibronectin.RevA binding to fibronectin was not inhibited by salt or heparin, suggestingthat adhesin-ligand interactions are primarily non-ionic and occur through thenon-heparin-binding regions of the fibronectin amino terminal domains. revAgenes are widely distributed among Lyme disease spirochetes, and the presentstudies determined that all tested RevA alleles bound fibronectin. In addition,RevB, a paralogous protein found in a subset of B. burgdorferi strains, alsobound fibronectin. We also confirmed that RevA is produced during mammalianinfection but not during colonization of vector ticks, and identified that revAtranscription is controlled through a mechanism distinct from that of bbk32.
PMID: 19398540 [PubMed - as supplied by publisher]
Ps. Fibronektiini on glykoproteiini, jolla on spesifisiä vuorovaikutuksia solujen, kollageenien, bakteerien, fibriinin ja glykosaminoglykaanien kanssa... Fibronektiinillä on tärkeä merkitys solujen kiinnittymisessä, liikkeiden ohjailussa ja bakteerien fagosytoinnissa.
http://www.solunetti.fi/fi/solubiologia ... ektiini/2/
Infect Immun. 2009 Apr 27; [Epub ahead of print] The Borrelia burgdorferi RevA antigen binds host fibronectin. Brissette CA, Bykowski T, Cooley AE, Bowman A, Stevenson B. Department of Microbiology, Immunology, and Molecular Genetics, University ofKentucky.
Borrelia burgdorferi, the Lyme disease spirochete, can persistently infect itsvertebrate hosts for years. B. burgdorferi is often found associated with hostconnective tissue, where it interacts with components of the extracellularmatrix, including fibronectin. Some years ago, a borrelial surface protein,named BBK32, was identified as a fibronectin-binding protein. However, B.burgdorferi bbk32 mutants are still able to bind fibronectin, indicating thatthe spirochete possesses additional mechanisms for adherence to fibronectin. Wenow demonstrate that RevA, an unrelated B. burgdorferi outer surface protein,binds mammalian fibronectin in a saturable manner. Site-directed mutagenesisstudies identified the amino terminus of the RevA protein as being required inadhesion to fibronectin. RevA bound to the amino-terminal region of fibronectin.RevA binding to fibronectin was not inhibited by salt or heparin, suggestingthat adhesin-ligand interactions are primarily non-ionic and occur through thenon-heparin-binding regions of the fibronectin amino terminal domains. revAgenes are widely distributed among Lyme disease spirochetes, and the presentstudies determined that all tested RevA alleles bound fibronectin. In addition,RevB, a paralogous protein found in a subset of B. burgdorferi strains, alsobound fibronectin. We also confirmed that RevA is produced during mammalianinfection but not during colonization of vector ticks, and identified that revAtranscription is controlled through a mechanism distinct from that of bbk32.
PMID: 19398540 [PubMed - as supplied by publisher]
"Borreliabakteerin aiheuttamat krooniset infektiot ovat oireistoltaan paljon moninaisempia kuin on aiemmin luultu. Bakteeri aiheuttaa esim. erilaisia kroonisia keskushermosto-oireita" (Itävalta):
Wien Klin Wochenschr. 1990 Jan 5;102(1):4-12.Related Articles, Links
[Recurrent and relapsing course of borreliosis of the nervous system]
[Article in German]
Omasits M, Seiser A, Brainin M.
Neurologische Abteilung, NO Landeskrankenhaus, Klosterneuburg.
The clinical variability of chronic infections due to Borrelia burgdorferi is greater than previously thought. Three personal cases are presented in an overview, together with cases from the literature. Chronic spastic para- and quadriparesis, transverse myelitis and recurrent hemiparesis have been noted in such cases. Frequently, there is additional involvement of the cranial nerves. Chronic polyneuritis, mononeuritis multiplex, as well as plexus neuritis can also occur. Psychiatric manifestations can at times be predominant. Their spectrum ranges from agitated depressive states with suicidal ideas to the clinical picture of dementia. Due to the high percentage of positive antibody titre reactions in the normal population, reliable evidence of a chronic infection of the nervous system is based on the examination of the cerebrospinal fluid. Lesions seen on CT and MRI are mostly uncharacteristic and bear no clear-cut relationship to the disease. Neurological signs and symptoms can be improved by antibiotic treatment.
Wien Klin Wochenschr. 1990 Jan 5;102(1):4-12.Related Articles, Links
[Recurrent and relapsing course of borreliosis of the nervous system]
[Article in German]
Omasits M, Seiser A, Brainin M.
Neurologische Abteilung, NO Landeskrankenhaus, Klosterneuburg.
The clinical variability of chronic infections due to Borrelia burgdorferi is greater than previously thought. Three personal cases are presented in an overview, together with cases from the literature. Chronic spastic para- and quadriparesis, transverse myelitis and recurrent hemiparesis have been noted in such cases. Frequently, there is additional involvement of the cranial nerves. Chronic polyneuritis, mononeuritis multiplex, as well as plexus neuritis can also occur. Psychiatric manifestations can at times be predominant. Their spectrum ranges from agitated depressive states with suicidal ideas to the clinical picture of dementia. Due to the high percentage of positive antibody titre reactions in the normal population, reliable evidence of a chronic infection of the nervous system is based on the examination of the cerebrospinal fluid. Lesions seen on CT and MRI are mostly uncharacteristic and bear no clear-cut relationship to the disease. Neurological signs and symptoms can be improved by antibiotic treatment.
Norja 2009. Tutkimuksessa seurattiin neuroborrelioosia sairastavien oireiden esiintymistä vuoden kuluttua hoitojen päättymisestä. 85:sta potilaasta noin puolella esiintyi edelleen oireita, osalla objektiivisia, osalla subjektiivisia. Oireita esiintyi erityisesti sellaisilla henkilöillä joiden oireet olivat kestäneet yli 6 viikkoa ennen hoitojen aloittamista. Oligoklonaalisten fraktioiden esiintyminen selkäydinnesteessä saattaa ennustaa oireiden pitkittymistä.
European Journal of Neurology Remaining complaints 1 year after treatment for acute Lyme neuroborreliosis; frequency, pattern and risk factors
U. Ljøstad a and Å. Mygland a,b,c a Department of Neurology, Sørlandet Hospital HF, Kristiansand, Norway ; b Hospital for Rehabilitation, Rikshospitalet University Hospital, Kristiansand, Norway ; and c Institute of Clinical Medicine, University of Bergen, Bergen, Norway Correspondence to U. Ljøstad, Department of Neurology, Sørlandet Hospital HF, Kristiansand, Serviceboks 416, N-4604 Kristiansand, Norway (tel.: +4738073910; fax: +4738073911;e-mail: unn.ljostad@sshf.no; aase.mygland@sshf.no). Copyright Journal compilation © 2009 European Federation of Neurological Societies
ABSTRACT Background and purpose: To chart remaining complaints 1 year after treatment for neuroborreliosis, and to identify risk factors for a non-favorable outcome. Methods: We followed patients treated for neuroborreliosis prospectively, and assessed outcome by a composite clinical score. The impact on outcome of clinical, demographic and laboratory factors were analyzed by univariate analyses and logistic regression.
Results: Out of 85 patients 41 (48%) had remaining complaints; 14 had objective findings and 27 subjective symptoms. Remaining complaints were associated with pre-treatment symptom duration ?6 weeks (OR = 4.062, P = 0.044), high pre-treatment cerebrospinal fluid (CSF) cell count (OR = 1.005, P = 0.001), and female gender (OR = 3.218, P = 0.025). Presence of CSF oligoclonal bands (OCBs) was not analyzed in the logistic regression model due to many missing observations, but was found to be more frequent both pre-treatment (P = 0.004) and after 12 months (P = 0.015) among patients with remaining complaints as compared to patients with complete recovery.
Further evaluation showed that objective remaining findings, and not subjective symptoms, were associated with pre-treatment symptom duration 6 weeks. No difference in outcome was observed between patients treated with IV ceftriaxone and patients treated with oral doxycycline.
Conclusion: Remaining complaints are common after neuroborreliosis. The majority of the complaints are subjective. Pre-treatment symptom duration ^ 6 weeks, high pre-treatment CSF cell count, and female gender seem to be risk factors for remaining complaints. Presence of CSF OCBs may also predict a non-favorable outcome, but this should be further studied. Whether subjective and objective complaints are associated with different risk factors is also an issue for future studies. Received 11 April 2009 Accepted 26 June 2009DIGITAL OBJECT IDENTIFIER (DOI)10.1111/j.1468-1331.2009.02756.x About DOI
European Journal of Neurology Remaining complaints 1 year after treatment for acute Lyme neuroborreliosis; frequency, pattern and risk factors
U. Ljøstad a and Å. Mygland a,b,c a Department of Neurology, Sørlandet Hospital HF, Kristiansand, Norway ; b Hospital for Rehabilitation, Rikshospitalet University Hospital, Kristiansand, Norway ; and c Institute of Clinical Medicine, University of Bergen, Bergen, Norway Correspondence to U. Ljøstad, Department of Neurology, Sørlandet Hospital HF, Kristiansand, Serviceboks 416, N-4604 Kristiansand, Norway (tel.: +4738073910; fax: +4738073911;e-mail: unn.ljostad@sshf.no; aase.mygland@sshf.no). Copyright Journal compilation © 2009 European Federation of Neurological Societies
ABSTRACT Background and purpose: To chart remaining complaints 1 year after treatment for neuroborreliosis, and to identify risk factors for a non-favorable outcome. Methods: We followed patients treated for neuroborreliosis prospectively, and assessed outcome by a composite clinical score. The impact on outcome of clinical, demographic and laboratory factors were analyzed by univariate analyses and logistic regression.
Results: Out of 85 patients 41 (48%) had remaining complaints; 14 had objective findings and 27 subjective symptoms. Remaining complaints were associated with pre-treatment symptom duration ?6 weeks (OR = 4.062, P = 0.044), high pre-treatment cerebrospinal fluid (CSF) cell count (OR = 1.005, P = 0.001), and female gender (OR = 3.218, P = 0.025). Presence of CSF oligoclonal bands (OCBs) was not analyzed in the logistic regression model due to many missing observations, but was found to be more frequent both pre-treatment (P = 0.004) and after 12 months (P = 0.015) among patients with remaining complaints as compared to patients with complete recovery.
Further evaluation showed that objective remaining findings, and not subjective symptoms, were associated with pre-treatment symptom duration 6 weeks. No difference in outcome was observed between patients treated with IV ceftriaxone and patients treated with oral doxycycline.
Conclusion: Remaining complaints are common after neuroborreliosis. The majority of the complaints are subjective. Pre-treatment symptom duration ^ 6 weeks, high pre-treatment CSF cell count, and female gender seem to be risk factors for remaining complaints. Presence of CSF OCBs may also predict a non-favorable outcome, but this should be further studied. Whether subjective and objective complaints are associated with different risk factors is also an issue for future studies. Received 11 April 2009 Accepted 26 June 2009DIGITAL OBJECT IDENTIFIER (DOI)10.1111/j.1468-1331.2009.02756.x About DOI
USA 2009. A. Steere ym. tutkivat 124:n borrelioosia sairastavan ja erityisesti niveltulehdusta kärsivän potilaan nivelnestenäytteitä. Potilaiden tilannetta oli seurattu 30 vuoden ajan. Tutkimuksessa selvisi että bakteeria ei ole saatu antibiooteilla tuhottua kaikissa tapauksissa. Erityisesti RST1 -kanta oli antibiooteille resistentti, erityisen virulentti ja aiheutti vaikeamman niveltulehduksen.
Kathryn L. Jones, Gail A. McHugh, Lisa J. Glickstein, Allen C. Steere. Analysis of Borrelia burgdorferi Genotypes in Patients with Lyme Arthritis. Arthritis & Rheumatism, July 2009 DOI: 10.1002/art.24811
A new study led by Allen Steere of Massachusetts General Hospital and Harvard Medical School analyzed joint fluid samples from 124 patients with Lyme arthritis who were seen over a 30-year period. It identified B. burgdorferi strains in the joints of patients with Lyme arthritis and found that the genotype frequencies in joints reflected those in skin lesions. However, RST1 strains were the most frequent in patients with antibiotic-refractory arthritis.
The researchers were able to identify 10 of the 16 B burgdorferi OspC types found in the northeastern U.S. and all three RST types in the joint fluid of patients with Lyme arthritis. Although it was only possible to determine B burgdorferi phenotypes in 40 percent of the samples, the researchers feel confident that the distribution reflects what has been observed in the skin because they were able to identify numerous OspC and RST types, and the distribution was similar to what has been reported in previous studies of skin lesions.
One might presume that the association of RST1 strains with antibiotic-refractory arthritis may reflect a greater ability of these strains to survive in the joint despite antibiotic therapy. However, this seems not to be the case. Rather, RST1 strains seem to induce a more marked immune response, which may set the stage for joint inflammation that persists after antibiotic therapy in genetically susceptible individuals.
?We hypothesize that RST1 strains are more virulent, leading to larger numbers of organisms in blood, and more inflammation in joints,? the authors state. They conclude that the results of this study ?add to the emerging literature concerning the differential pathogenicity of strains of B burgdorferi.?
Kathryn L. Jones, Gail A. McHugh, Lisa J. Glickstein, Allen C. Steere. Analysis of Borrelia burgdorferi Genotypes in Patients with Lyme Arthritis. Arthritis & Rheumatism, July 2009 DOI: 10.1002/art.24811
A new study led by Allen Steere of Massachusetts General Hospital and Harvard Medical School analyzed joint fluid samples from 124 patients with Lyme arthritis who were seen over a 30-year period. It identified B. burgdorferi strains in the joints of patients with Lyme arthritis and found that the genotype frequencies in joints reflected those in skin lesions. However, RST1 strains were the most frequent in patients with antibiotic-refractory arthritis.
The researchers were able to identify 10 of the 16 B burgdorferi OspC types found in the northeastern U.S. and all three RST types in the joint fluid of patients with Lyme arthritis. Although it was only possible to determine B burgdorferi phenotypes in 40 percent of the samples, the researchers feel confident that the distribution reflects what has been observed in the skin because they were able to identify numerous OspC and RST types, and the distribution was similar to what has been reported in previous studies of skin lesions.
One might presume that the association of RST1 strains with antibiotic-refractory arthritis may reflect a greater ability of these strains to survive in the joint despite antibiotic therapy. However, this seems not to be the case. Rather, RST1 strains seem to induce a more marked immune response, which may set the stage for joint inflammation that persists after antibiotic therapy in genetically susceptible individuals.
?We hypothesize that RST1 strains are more virulent, leading to larger numbers of organisms in blood, and more inflammation in joints,? the authors state. They conclude that the results of this study ?add to the emerging literature concerning the differential pathogenicity of strains of B burgdorferi.?
Borreliabakteerin on todettu muodostavan ns. biofilmiyhteisöjä. Samanlaista muodostusta on tavattu myös esim. kroonisissa virtstieinfektioissa, Crohnin taudissa, helikobakteerin kohdalla jne. Alla on esitetty artikkeli ja muutamia tutkimuksia asiasta.
Tri Jon Sterngold:
"Borreliabakteeri on ainutlaatuinen bakteerien joukossa esim DNA rakenteensa vuoksi. Lukuisat DNA:t mahdollistavat bakteerin selviämisen elimistössä ja pakenemisen immuunipuolustuksen tuhoamisyrityksiltä. Bakteeri kykenee esim. muuntamaan pintaproteiinejaan. Bakteeri kykenee muuntamaan myös muotoaan korkkiruuvimaisesta muodosta kystamuotoon. Kystamuodossa bakteeri on erittäin vastustuskykyinen.
Antibioottihoidon teho riippuu bakteerin aktiivisuustasosta; miten nopeasti bakteeri kasvaa ja lisääntyy. Useimmat bakteerit (useimmat virtsatieinfektiot, keuhkokuume jne.) lisääntyvät alle 24 tunnissa. Tällaisissa infektioissa ihminen saa yleensä nopeasti avun antibiooteista. Borreliabakteerin lisääntymissykli on jopa yhdeksän kuukauden mittainen. Passiivisessa tilassa olevaa bakteeria on erittäin vaikea saada tuhotuksi hoidoilla.
Sen lisäksi joidenkin tutkimusten mukaan borreliabakteeri muodostaa muiden taudinaiheuttajien kanssa myös ns. biofilmi-yhteisöjä.
Mikroskoopissa tämä nähdään bakteerien kerääntymisenä geelimäisiin "kasoihin". Tällöin ne ovat suojassa immuunipuolustukselta ja antibiooteilta. Tässä "bunkkerissa" niistä kuitenkin vapautuu (aineenvaihdunnallisen kierron aikana) esim. hermostolle myrkyllisiä aineita. Kyseessä on taistelu elintilasta. Bakteerit voivat tarpeidensa mukaisesti esim. heikentää ihmisen puolustujärjestelmiä tai muuttaa muita elintomintoja. Niiden tarkoituksena ei ole tuhota isäntäelimistöä vaikka sitäkin joskus tapahtuu.
Aivo-, hermo-, sydän-, verisuoni-, tukikudosten, nivelten jne. tulehdusten lisäksi borreliabakteeri pystyy aiheuttamaan ns. autoimmuunisairauksia kuten ALS, lupus, MS jne. Kyseisiä oireita pidetään parantumattomina mutta monissa tapauksissa pitkillä, korkea-annoksisilla antibioottihoidoilla taudit on saatu jopa parannettua.
Borrelioositestit ovat ongelmallisia. Yleensä testeissä mitataan elimistön kykyä muodostaa vasta-aineita borreliabakteeria kohtaan. MUTTA bakteeri kykenee piiloutumaan, muuntumaan, heikentämään elimistön kykyä muodostaa vasta-aineita. SIKSI testitulokset voivat olla täysin negatiiviset vaikkka henkilö sairastaa borrelioosia. Näemme usein, että esim. vuoden antibioottihoitojen jälkeen immmuunipuolustus viimein kykenee havaitsemaan joitakin bakteerin jäänteitä ja testitulokset muuttuvat positiivisiksi. Potilaalla on kuitenkin ongelmia mikäli häntä hoitava lääkäri luottaa ainoastaan negatiivisiin testituloksiin. Tällöin hän ei saa asianmukaista hoitoa ja kärsimykset jatkuvat.
Tässä vaiheessa erottuvat sellaiset lääkärit, jotka ymmärtävät testeihin liittyvät ongelmat ja hoitoihin liittyvät haasteet niistä lääkäreistä, jotka eivät osaa tai eivät halua ymmärtää bakteeriin/tautiin liittyviä ongemia. Ongelman laajuus ja syvyys on erittäin suuri tänä päivänä."
http://www.willitsnews.com/ci_13453460
----------------------------------------------------------------------------------
Hideo Yonezawa1 , Takako Osaki1 , Satoshi Kurata1 , Minoru Fukuda2 , Hayato Kawakami3 , Kuniyasu Ochiai4 , Tomoko Hanawa1 and Shigeru Kamiya1
1Department of Infectious Disease, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
2Laboratory for Electron Microscopy, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
3Department of Anatomy, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
4Department of Bacteriology, Nihon University School of Dentistry, Kanda-Surugadai, Chiyoda-ku, Tokyo, 101-8310, Japan
author email corresponding author email
BMC Microbiology 2009, 9:197doi:10.1186/1471-2180-9-197
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2180/9/197
Received: 23 March 2009
Accepted: 15 September 2009
Published: 15 September 2009
© 2009 Yonezawa et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Helicobacter pylori forms biofilms on glass surfaces at the air-liquid interface in in vitro batch cultures; however, biofilms of H. pylori have not been well characterized. In the present study, we analyzed the ability of H. pylori strains to form biofilms and characterized the underlying mechanisms of H. pylori biofilm formation.
Results
Strain TK1402 showed strong biofilm forming ability relative to the other strains in Brucella broth supplemented with 7% FCS. The strong biofilm forming ability of TK1402 is reflected the relative thickness of the biofilms. In addition, outer membrane vesicles (OMV) were detected within the matrix of only the TK1402 biofilms. Biofilm formation was strongly correlated with the production of OMV in this strain. We further observed that strain TK1402 did not form thick biofilms in Brucella broth supplemented with 0.2% β-cyclodextrin. However, the addition of the OMV-fraction collected from TK1402 could enhance biofilm formation.
Conclusion
The results suggested that OMV produced from TK1402 play an important role in biofilm formation in strain TK1402.
Background
Helicobacter pylori is a spiral, microaerophilic, noninvasive, gram-negative bacterium that colonizes the human gastrointestinal tract, primarily the stomach [1]. This organism has been identified as an aetiological agent of chronic active gastritis, peptic ulcer disease [2,3], gastric adenocarcinoma [4], and mucosa-associated lymphoid tissue (MALT) lymphoma [5]. A number of factors such as the VacA cytotoxin, the cag pathogenicity island (cag PAI), motility, and the urease enzyme are known to be involved in the virulence of this organism [6-8].
Biofilm development is initiated when bacteria transit from a planktonic state to a lifestyle in which the microorganisms are firmly attached to biotic or abiotic surfaces, and biofilms are strongly implicated in bacterial virulence [9]. Biofilm formation is critical not only for environmental survival but also for successful infection by numerous pathogenic bacteria. Among human bacterial pathogens, the biofilms of Pseudomonas aeruginosa, Haemophilus influenzae, pathogenic Escherichia coli, Vibrio cholerae, staphylococci and streptococci are some of the best studied [10-14]. Bacterial biofilms are frequently embedded in a self-produced extracellular matrix [15]. The extracellular polymeric substance (EPS) matrix, which can constitute up to 90% of the biofilm biomass, is a complex mixture of exopolysaccharides, proteins, DNA and other macromolecules [16].
Previous studies have alluded to the ability of H. pylori to form biofilms [17,18]. A polysaccharide-containing biofilm has been observed at the air-liquid interface when H. pylori was grown in a glass fermenter [17]. H. pylori is also capable of binding to a heterotrophic mixed species biofilm grown on stainless steel coupons [18]. Recent studies indicated that 10 strains including some animal-adapted strains, clinical isolates and laboratory strains, were able to form similar three-dimensional architectures implicated in biofilm development [19,20]. Cellini et al. reported that an environmental H. pylori strain, named MDC1, displayed a well structured biofilm [19]. Cole et al. also indicated that mucin greatly accelerated planktonic growth relative to the expansion of H. pylori biofilms [2]. In addition, a recent study indicated that H. pylori can exist in human gastric mucosa forming biofilms [21]. These studies indicated that the topic of biofilm formation in this organism has the potential to contribute to our knowledge of H. pylori pathogenesis. However, little is known regarding the mechanism of H. pylori biofilm development. In the present study, we characterized the ability of 4 reference strains and 4 clinical isolates of H. pylori to form biofilms. Furthermore, we investigated the potential role of outer membrane vesicles (OMV) released from this organism in biofilm development.
-----------------------------------------------------------------------------------------------------------
Biofilm formation as a novel phenotypic feature of adherent-invasive Escherichia coli (AIEC)
Margarita Martinez-Medina , Plinio Naves , Jorge Blanco , Xavier Aldeguer , Jesus E Blanco , Miguel Blanco , Carmen Ponte , Francisco Soriano , Arlette Darfeuille-Michaud and L. Jesus Garcia-Gil
BMC Microbiology 2009, 9:202doi:10.1186/1471-2180-9-202
Published: 21 September 2009
Abstract (provisional)
Background
Crohn's disease (CD) is a high morbidity chronic inflammatory disorder of unknown aetiology. Adherent-invasive Escherichia coli (AIEC) has been recently implicated in the origin and perpetuation of CD. Because bacterial biofilms in the gut mucosa are suspected to play a role in CD and biofilm formation is a feature of certain pathogenic E. coli strains, we compared the biofilm formation capacity of 27 AIEC and 38 non-AIEC strains isolated from the intestinal mucosa. Biofilm formation capacity was then contrasted with the AIEC phenotype, the serotype, the phylotype, and the presence of virulence genes.
Results
Specific biofilm formation (SBF) indices were higher amongst AIEC than non-AIEC strains (P=0.012). In addition, 65.4% of moderate to strong biofilms producers were AIEC, whereas 74.4% of weak biofilm producers were non-AIEC (P=0.002). These data indicate that AIEC strains were more efficient biofilm producers than non-AIEC strains. Moreover, adhesion (P=0.009) and invasion (P=0.003) indices correlated positively with higher SBF indices. Additionally, motility (100%, P<0.001), H1 type flagellin (53.8%, P<0.001), serogroups O83 (19.2%, P=0.008) and O22 (26.9%, P=0.001), the presence of virulence genes such as sfa/focDE (38.5%, P=0.003) and ibeA (26.9%, P=0.017), and B2 phylotype (80.8%, P<0.001) were frequent characteristics amongst biofilm producers.
Conclusions
The principal contribution of the present work is the finding that biofilm formation capacity is a novel, complementary pathogenic feature of the recently described AIEC pathovar. Characterization of AIEC specific genetic determinants, and the regulatory pathways, involved in biofilm formation will likely bring new insights into AIEC pathogenesis.
http://www.biomedcentral.com/1471-2180/9/202/abstract
----------------------------------------------------------------------
SCIENCE, Volume 301, Number 5629: Pages 105-107,
July 4, 2003.
Intracellular bacterial biofilm-like pods in urinary tract infections.
Anderson GG, Palermo JJ, Schilling JD, Roth R, Heuser J, Hultgren SJ.
Department of Molecular Microbiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, USA.
Escherichia coli entry into the bladder is met with potent innate defenses, including neutrophil influx and epithelial exfoliation. Bacterial subversion of innate responses involves invasion into bladder superficial cells. We discovered that the intracellular bacteria matured into biofilms, creating pod-like bulges on the bladder surface. Pods contained bacteria encased in a polysaccharide-rich matrix surrounded by a protective shell of uroplakin. Within the biofilm, bacterial structures interacted extensively with the surrounding matrix, and biofilm associated factors had regional variation in expression. The discovery of intracellular biofilm-like pods explains how bladder infections can persist in the face of robust host defenses.
PMID: 12843396 [PubMed - indexed for MEDLINE]
[CIRP Note: See also: Berger A. Burrowing bacteria may explain recurrent urinary tract infections. BMJ 1998;317:1473. See also: Understanding Urinary Tract Infections: Scientists Film Bacteria Changing, Collaborating to Defeat Bladder Cell Defenses.]
--------------------------------------------------------------------------------
Citation:
Anderson GG, Palermo JJ, Schilling JD, Roth R, Heuser J, Hultgren SJ. Intracellular bacterial biofilm-like pods in urinary tract infections. Science 2003; 301(5629):105-7.
Tri Jon Sterngold:
"Borreliabakteeri on ainutlaatuinen bakteerien joukossa esim DNA rakenteensa vuoksi. Lukuisat DNA:t mahdollistavat bakteerin selviämisen elimistössä ja pakenemisen immuunipuolustuksen tuhoamisyrityksiltä. Bakteeri kykenee esim. muuntamaan pintaproteiinejaan. Bakteeri kykenee muuntamaan myös muotoaan korkkiruuvimaisesta muodosta kystamuotoon. Kystamuodossa bakteeri on erittäin vastustuskykyinen.
Antibioottihoidon teho riippuu bakteerin aktiivisuustasosta; miten nopeasti bakteeri kasvaa ja lisääntyy. Useimmat bakteerit (useimmat virtsatieinfektiot, keuhkokuume jne.) lisääntyvät alle 24 tunnissa. Tällaisissa infektioissa ihminen saa yleensä nopeasti avun antibiooteista. Borreliabakteerin lisääntymissykli on jopa yhdeksän kuukauden mittainen. Passiivisessa tilassa olevaa bakteeria on erittäin vaikea saada tuhotuksi hoidoilla.
Sen lisäksi joidenkin tutkimusten mukaan borreliabakteeri muodostaa muiden taudinaiheuttajien kanssa myös ns. biofilmi-yhteisöjä.
Mikroskoopissa tämä nähdään bakteerien kerääntymisenä geelimäisiin "kasoihin". Tällöin ne ovat suojassa immuunipuolustukselta ja antibiooteilta. Tässä "bunkkerissa" niistä kuitenkin vapautuu (aineenvaihdunnallisen kierron aikana) esim. hermostolle myrkyllisiä aineita. Kyseessä on taistelu elintilasta. Bakteerit voivat tarpeidensa mukaisesti esim. heikentää ihmisen puolustujärjestelmiä tai muuttaa muita elintomintoja. Niiden tarkoituksena ei ole tuhota isäntäelimistöä vaikka sitäkin joskus tapahtuu.
Aivo-, hermo-, sydän-, verisuoni-, tukikudosten, nivelten jne. tulehdusten lisäksi borreliabakteeri pystyy aiheuttamaan ns. autoimmuunisairauksia kuten ALS, lupus, MS jne. Kyseisiä oireita pidetään parantumattomina mutta monissa tapauksissa pitkillä, korkea-annoksisilla antibioottihoidoilla taudit on saatu jopa parannettua.
Borrelioositestit ovat ongelmallisia. Yleensä testeissä mitataan elimistön kykyä muodostaa vasta-aineita borreliabakteeria kohtaan. MUTTA bakteeri kykenee piiloutumaan, muuntumaan, heikentämään elimistön kykyä muodostaa vasta-aineita. SIKSI testitulokset voivat olla täysin negatiiviset vaikkka henkilö sairastaa borrelioosia. Näemme usein, että esim. vuoden antibioottihoitojen jälkeen immmuunipuolustus viimein kykenee havaitsemaan joitakin bakteerin jäänteitä ja testitulokset muuttuvat positiivisiksi. Potilaalla on kuitenkin ongelmia mikäli häntä hoitava lääkäri luottaa ainoastaan negatiivisiin testituloksiin. Tällöin hän ei saa asianmukaista hoitoa ja kärsimykset jatkuvat.
Tässä vaiheessa erottuvat sellaiset lääkärit, jotka ymmärtävät testeihin liittyvät ongelmat ja hoitoihin liittyvät haasteet niistä lääkäreistä, jotka eivät osaa tai eivät halua ymmärtää bakteeriin/tautiin liittyviä ongemia. Ongelman laajuus ja syvyys on erittäin suuri tänä päivänä."
http://www.willitsnews.com/ci_13453460
----------------------------------------------------------------------------------
Hideo Yonezawa1 , Takako Osaki1 , Satoshi Kurata1 , Minoru Fukuda2 , Hayato Kawakami3 , Kuniyasu Ochiai4 , Tomoko Hanawa1 and Shigeru Kamiya1
1Department of Infectious Disease, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
2Laboratory for Electron Microscopy, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
3Department of Anatomy, Kyorin University School of Medicine, Shinkawa, Mitaka, Tokyo, 181-8611, Japan
4Department of Bacteriology, Nihon University School of Dentistry, Kanda-Surugadai, Chiyoda-ku, Tokyo, 101-8310, Japan
author email corresponding author email
BMC Microbiology 2009, 9:197doi:10.1186/1471-2180-9-197
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2180/9/197
Received: 23 March 2009
Accepted: 15 September 2009
Published: 15 September 2009
© 2009 Yonezawa et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Helicobacter pylori forms biofilms on glass surfaces at the air-liquid interface in in vitro batch cultures; however, biofilms of H. pylori have not been well characterized. In the present study, we analyzed the ability of H. pylori strains to form biofilms and characterized the underlying mechanisms of H. pylori biofilm formation.
Results
Strain TK1402 showed strong biofilm forming ability relative to the other strains in Brucella broth supplemented with 7% FCS. The strong biofilm forming ability of TK1402 is reflected the relative thickness of the biofilms. In addition, outer membrane vesicles (OMV) were detected within the matrix of only the TK1402 biofilms. Biofilm formation was strongly correlated with the production of OMV in this strain. We further observed that strain TK1402 did not form thick biofilms in Brucella broth supplemented with 0.2% β-cyclodextrin. However, the addition of the OMV-fraction collected from TK1402 could enhance biofilm formation.
Conclusion
The results suggested that OMV produced from TK1402 play an important role in biofilm formation in strain TK1402.
Background
Helicobacter pylori is a spiral, microaerophilic, noninvasive, gram-negative bacterium that colonizes the human gastrointestinal tract, primarily the stomach [1]. This organism has been identified as an aetiological agent of chronic active gastritis, peptic ulcer disease [2,3], gastric adenocarcinoma [4], and mucosa-associated lymphoid tissue (MALT) lymphoma [5]. A number of factors such as the VacA cytotoxin, the cag pathogenicity island (cag PAI), motility, and the urease enzyme are known to be involved in the virulence of this organism [6-8].
Biofilm development is initiated when bacteria transit from a planktonic state to a lifestyle in which the microorganisms are firmly attached to biotic or abiotic surfaces, and biofilms are strongly implicated in bacterial virulence [9]. Biofilm formation is critical not only for environmental survival but also for successful infection by numerous pathogenic bacteria. Among human bacterial pathogens, the biofilms of Pseudomonas aeruginosa, Haemophilus influenzae, pathogenic Escherichia coli, Vibrio cholerae, staphylococci and streptococci are some of the best studied [10-14]. Bacterial biofilms are frequently embedded in a self-produced extracellular matrix [15]. The extracellular polymeric substance (EPS) matrix, which can constitute up to 90% of the biofilm biomass, is a complex mixture of exopolysaccharides, proteins, DNA and other macromolecules [16].
Previous studies have alluded to the ability of H. pylori to form biofilms [17,18]. A polysaccharide-containing biofilm has been observed at the air-liquid interface when H. pylori was grown in a glass fermenter [17]. H. pylori is also capable of binding to a heterotrophic mixed species biofilm grown on stainless steel coupons [18]. Recent studies indicated that 10 strains including some animal-adapted strains, clinical isolates and laboratory strains, were able to form similar three-dimensional architectures implicated in biofilm development [19,20]. Cellini et al. reported that an environmental H. pylori strain, named MDC1, displayed a well structured biofilm [19]. Cole et al. also indicated that mucin greatly accelerated planktonic growth relative to the expansion of H. pylori biofilms [2]. In addition, a recent study indicated that H. pylori can exist in human gastric mucosa forming biofilms [21]. These studies indicated that the topic of biofilm formation in this organism has the potential to contribute to our knowledge of H. pylori pathogenesis. However, little is known regarding the mechanism of H. pylori biofilm development. In the present study, we characterized the ability of 4 reference strains and 4 clinical isolates of H. pylori to form biofilms. Furthermore, we investigated the potential role of outer membrane vesicles (OMV) released from this organism in biofilm development.
-----------------------------------------------------------------------------------------------------------
Biofilm formation as a novel phenotypic feature of adherent-invasive Escherichia coli (AIEC)
Margarita Martinez-Medina , Plinio Naves , Jorge Blanco , Xavier Aldeguer , Jesus E Blanco , Miguel Blanco , Carmen Ponte , Francisco Soriano , Arlette Darfeuille-Michaud and L. Jesus Garcia-Gil
BMC Microbiology 2009, 9:202doi:10.1186/1471-2180-9-202
Published: 21 September 2009
Abstract (provisional)
Background
Crohn's disease (CD) is a high morbidity chronic inflammatory disorder of unknown aetiology. Adherent-invasive Escherichia coli (AIEC) has been recently implicated in the origin and perpetuation of CD. Because bacterial biofilms in the gut mucosa are suspected to play a role in CD and biofilm formation is a feature of certain pathogenic E. coli strains, we compared the biofilm formation capacity of 27 AIEC and 38 non-AIEC strains isolated from the intestinal mucosa. Biofilm formation capacity was then contrasted with the AIEC phenotype, the serotype, the phylotype, and the presence of virulence genes.
Results
Specific biofilm formation (SBF) indices were higher amongst AIEC than non-AIEC strains (P=0.012). In addition, 65.4% of moderate to strong biofilms producers were AIEC, whereas 74.4% of weak biofilm producers were non-AIEC (P=0.002). These data indicate that AIEC strains were more efficient biofilm producers than non-AIEC strains. Moreover, adhesion (P=0.009) and invasion (P=0.003) indices correlated positively with higher SBF indices. Additionally, motility (100%, P<0.001), H1 type flagellin (53.8%, P<0.001), serogroups O83 (19.2%, P=0.008) and O22 (26.9%, P=0.001), the presence of virulence genes such as sfa/focDE (38.5%, P=0.003) and ibeA (26.9%, P=0.017), and B2 phylotype (80.8%, P<0.001) were frequent characteristics amongst biofilm producers.
Conclusions
The principal contribution of the present work is the finding that biofilm formation capacity is a novel, complementary pathogenic feature of the recently described AIEC pathovar. Characterization of AIEC specific genetic determinants, and the regulatory pathways, involved in biofilm formation will likely bring new insights into AIEC pathogenesis.
http://www.biomedcentral.com/1471-2180/9/202/abstract
----------------------------------------------------------------------
SCIENCE, Volume 301, Number 5629: Pages 105-107,
July 4, 2003.
Intracellular bacterial biofilm-like pods in urinary tract infections.
Anderson GG, Palermo JJ, Schilling JD, Roth R, Heuser J, Hultgren SJ.
Department of Molecular Microbiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, USA.
Escherichia coli entry into the bladder is met with potent innate defenses, including neutrophil influx and epithelial exfoliation. Bacterial subversion of innate responses involves invasion into bladder superficial cells. We discovered that the intracellular bacteria matured into biofilms, creating pod-like bulges on the bladder surface. Pods contained bacteria encased in a polysaccharide-rich matrix surrounded by a protective shell of uroplakin. Within the biofilm, bacterial structures interacted extensively with the surrounding matrix, and biofilm associated factors had regional variation in expression. The discovery of intracellular biofilm-like pods explains how bladder infections can persist in the face of robust host defenses.
PMID: 12843396 [PubMed - indexed for MEDLINE]
[CIRP Note: See also: Berger A. Burrowing bacteria may explain recurrent urinary tract infections. BMJ 1998;317:1473. See also: Understanding Urinary Tract Infections: Scientists Film Bacteria Changing, Collaborating to Defeat Bladder Cell Defenses.]
--------------------------------------------------------------------------------
Citation:
Anderson GG, Palermo JJ, Schilling JD, Roth R, Heuser J, Hultgren SJ. Intracellular bacterial biofilm-like pods in urinary tract infections. Science 2003; 301(5629):105-7.
Borreliabakteeria löydettiin kudoksista antibioottihoitojen jälkeenkin. (USA 2008)
Osalle hiiristä annettiin kuukauden antibioottihoito (keftriaksoni), osalle keittosuolaliuosta. Antibioottihoitoa saaneiden hiirten vasta-ainetestit olivat negatiiviset, MUTTA kudoksista tehty DNA-testi (PCR) oli positiivinen ja bakteeria löydettiin kollageenia sisältävistä kudoksista.
Persistence of Borrelia burgdorferi following Antibiotic Treatment in Mice
Antimicrob Agents Chemother. 2008 May; 52(5): 1728?1736.
Published online 2008 March 3. doi: 10.1128/AAC.01050-07. PMCID: PMC2346637
Copyright © 2008, American Society for Microbiology
Persistence of Borrelia burgdorferi following Antibiotic Treatment in Mice
Emir Hodzic, Sunlian Feng, Kevin Holden, Kimberly J. Freet, and Stephen W. Barthold*
Center for Comparative Medicine, Schools of Medicine and Veterinary Medicine, University of California at Davis, One Shields Avenue, Davis, California 95616
*Corresponding author. Mailing address: Center for Comparative Medicine, Schools of Medicine and Veterinary Medicine, University of California at Davis, One Shields Avenue, Davis, CA 95616. Phone: (530) 758-4964. Fax: (530) 758-7914. E-mail: swbarthold@ucdavis.edu
Received August 9, 2007; Revised November 1, 2007; Accepted December 26, 2007.
This article has been cited by other articles in PMC.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES AbstractThe effectiveness of antibiotic treatment was examined in a mouse model of Lyme borreliosis. Mice were treated with ceftriaxone or saline solution for 1 month, commencing during the early (3 weeks) or chronic (4 months) stages of infection with Borrelia burgdorferi. Tissues from mice were tested for infection by culture, PCR, xenodiagnosis, and transplantation of allografts at 1 and 3 months after completion of treatment. In addition, tissues were examined for the presence of spirochetes by immunohistochemistry.
In contrast to saline solution-treated mice, mice treated with antibiotic were consistently culture negative, but tissues from some of the mice remained PCR positive, and spirochetes could be visualized in collagen-rich tissues.
Furthermore, when some of the antibiotic-treated mice were fed on by Ixodes scapularis ticks (xenodiagnosis), spirochetes were acquired by the ticks, as determined based upon PCR results, and ticks from those cohorts transmitted spirochetes to naïve SCID mice, which became PCR positive but culture negative.
Results indicated that following antibiotic treatment, mice remained infected with nondividing but infectious spirochetes, particularly when antibiotic treatment was commenced during the chronic stage of infection.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES Lyme borreliosis is a multisystem disorder that arises from tick-transmitted infection with Borrelia burgdorferi. When infection is left untreated, B. burgdorferi can effectively evade host immune clearance, resulting in persistent infection that may or may not be manifested as clinical disease. Experimental studies of a wide variety of laboratory animals (mice [5], rats [35], hamsters [20], gerbils [44], dogs [62], and nonhuman primates [51]) indicate that persistent infection is the norm in fully immunocompetent hosts. There is some direct (culture) and indirect (DNA amplification) evidence for persistence in human cases as well (10, 17, 21, 23, 25, 38, 41, 45, 46, 47, 52, 56, 58 ).
The laboratory mouse is employed in extensively utilized models for Lyme borreliosis research. Mice develop many of the common manifestations of Lyme disease in humans, including arthritis, synovitis, carditis, myositis, and peripheral neuritis, but not the central nervous system disease or chronic unremitting arthritis that may occur in some human patients. In addition, the murine immune response to infection closely parallels that of humans (4). Studies of mice have revealed that spirochete numbers in tissues are highest during the early stage of infection and decline with the evolution of the host immune response (23). The evolution of host immunity results in global reduction of spirochete numbers in many tissues but fails to clear infection. In the persistent stage of infection, spirochetes are sequestered within highly collagenous areas of vessel walls, ligaments, and tendons. Spirochetes are also intercalated within collagen of the dermis, where ticks can acquire infection by feeding upon persistently infected mice (7). Evidence exists for persistence of spirochetes after antibiotic therapy in dogs, but the absence of clinical sequelae or culture positivity has raised questions about spirochete pathogenicity and viability (60, 61). Likewise, persisting B. burgdorferi infections in the ligamentous tissue (21), synovium (47), and skin (25, 45) of human patients following treatment with antibiotics have been documented.
In a study involving mice treated for 30 days with ceftriaxone or doxycycline, persistent infection was documented by detection of low levels of spirochetal DNA in tissues for up to 9 months and by feeding ticks upon the mice and then testing the ticks for spirochetes (xenodiagnosis). Infection could be detected by xenodiagnosis for up to 3 months after antibiotic treatment. Efforts to transmit infection to naïve mice from the infected ticks that fed on antibiotic-treated mice were not successful. Examination of the spirochetal DNA within positive-testing ticks suggested that the spirochetes had possibly lost genes or plasmids that were crucial for infectivity. It has been suggested that persisting spirochetes are attenuated and noninfectious (9). In another study using short-term ceftriaxone or ampicillin treatment in mice, spirochetal DNA could be detected in joint tissue but not in other tissues at 4 weeks after antibiotic treatment, but viable spirochetes could not be cultured (70). These results parallel those determined in studies of dogs treated with azithromycin, doxycycline, or ceftriaxone (61). The inability to culture spirochetes from DNA-positive tissues or to transmit spirochetes from infected ticks that fed on antibiotic-treated mice may be due to attenuation of spirochetes by antibiotics, as has been suggested, or may be due to the presence of a subpopulation of antibiotic-tolerant, nondividing ?persister? bacteria (37, 55).
The current study further investigated the issue of B. burgdorferi persistence following antibiotic therapy by examining mice treated with ceftriaxone during the early stage of infection compared to mice treated during the late stage of infection. A recent study has shown that there are significant shifts into or preferential survival of spirochetes in collagen during chronic infection (7), which may facilitate immune evasion and impact effectiveness of antibiotics.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES MATERIALS AND METHODSMice.
Three- to 5-week-old female C3H/HeN (C3H) specific-pathogen-free mice were purchased from the Frederick Cancer Research Center, Frederick, MD, and C3H.C-PrkdcscidIcrSmnHsd (C3H-scid, or SCID) mice were purchased from Harlan Sprague-Dawley, Inc., Indianapolis, IN. Mice were maintained in an isolation room within filter-top cages and were provided food and water ad libitum. Immediately prior to B. burgdorferi inoculation of mice and every month following inoculation, blood samples were obtained from their caudal veins. To detect the presence of infectious spirochetes in tissues following antibiotic or sham treatment, the distal ear pinnae were collected aseptically at necropsy and then transplanted through a pocket watch incision into the subcutis of naïve C3H or C3H-scid mice, as described previously (3, 6). Mice were subjected to necropsy following carbon dioxide narcosis and exsanguination by cardiocentesis. All experiments were approved by the University of California at Davis (UCD) Institutional Animal Care and Use Committee. The University of California at Davis is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International.
Borrelia burgdorferi.
A low-passage-number clonal strain of B. burgdorferi N40 (cN40) sensu stricto was grown in modified Barbour-Stoenner-Kelly (BSKII) medium, as described previously (2). Mice were infected by subdermal inoculation of 104 mid-log-phase spirochetes in 0.1 ml of BSKII medium on the dorsal thoracic midline. The infection status of mice was assessed by culture of inoculation site, urinary bladder, and quadriceps muscle tissue, as previously described (5). Infection was also assessed by PCR amplification of B. burgdorferi target genes in samples of ear, skin, heart base, ventricular muscle, tibiotarsal joint, and quadriceps muscle tissue (see below). The sensitivity of BSKII medium for detection of viable spirochetes was verified by serial 10-fold dilutions of a B. burgdorferi N40 culture. Triplicate cultures were inoculated with 105, 104, 103, 102, 101, 100, and 10−1 dilutions of spirochetes and examined for growth at 5 and 12 days. Spirochete growth occurred at all dilutions through 100, indicating the high degree of sensitivity of spirochete growth in BSKII medium.
Antibiotic.
Mice were treated with 16 mg/kg ceftriaxone in a 500-μl total volume of 0.9% normal saline solution administered intraperitoneally twice daily for 5 days and then once daily for 25 days. Sham-treated mice received a similar volume of saline solution. This dose has been previously shown to reach effective serum concentrations in mice following subcutaneous injection (9, 34). Serum ceftriaxone levels were evaluated in mice injected intraperitoneally with 16 mg/kg ceftriaxone-500 μl of saline solution and bled at 0, 1, 2, 4, 8, 12, and 24 h after treatment. Serum ceftriaxone levels were measured in triplicate 20-μl samples by use of an agar-based Staphylococcus aureus (ATCC 25923) inhibition assay, as described previously (34). Serum levels of ceftriaxone were 93 μg/ml, 20 μg/ml, and 2 μg/ml at 1, 2, and 4 h, respectively. No inhibition was detectable at 8 h or thereafter. These serum levels of ceftriaxone exceeded those measured in previous studies of mice given 16 mg/kg ceftriaxone subcutaneously (9, 34) and of dogs administered 25 mg/kg ceftriaxone intravenously (61).
The MIC and minimum bactericidal concentration (MBC) of ceftriaxone for B. burgdorferi N40 were determined to be 0.015 μg/ml (MIC) and 0.06 μg/ml (MBC), which are comparable to published MIC/MBC values of ceftriaxone for B. burgdorferi B31 (37, 55). Spirochetes (1 × 105 cells) were inoculated into 5-ml aliquots of liquid BSKII media prepared with serial 10-fold dilutions (100 μg/ml to 0.001 μg/ml) of ceftriaxone. The MIC was defined as the lowest concentration of ceftriaxone resulting in no visible growth of bacteria following incubation at 34°C for 3 days. Afterwards, 100 μl from each MIC culture was subcultured into 5 ml of BSKII media without antibiotics to determine the MBC, which was defined as the lowest corresponding concentration of ceftriaxone from the MIC cultures that demonstrated no visible growth following incubation at 34°C for 14 days. Tubes containing B. burgdorferi N40 without antibiotic and uninoculated media served as controls.
Ticks.
Ticks used in this study were members of a single population of larvae derived from a colony of laboratory-reared pathogen-free Ixodes scapularis ticks and were provided by Durland Fish of Yale University. Several days prior to necropsy, each of the mice was infested with approximately 40 larval ticks, which were allowed to feed to repletion. Engorged larvae were collected and allowed to molt into nymphs and harden, and then randomly selected members of tick cohorts from each mouse were tested for the presence of B. burgdorferi by PCR (xenodiagnosis). Nymphal ticks from these cohorts were used for transmission studies.
PCR analysis.
Spirochetal DNA was assessed by real-time quantitative PCR (Q-PCR), which was standardized and optimized for flagellin (flaB), outer surface protein A (ospA), and arthritis-related protein (arp), as described previously (23, 24). In addition, primers and an internal probe were developed for B. burgdorferi N40 vlsE. The B. burgdorferi N40 vlsE sequence has not been published, and primers based upon the B31 sequence failed to amplify vlsE from N40 DNA (data not shown). Therefore, an N40-specific sequence was obtained from an immunoreactive clone derived from screening an N40 genomic expression library with immune serum from infected mice, as described previously (14). The clone encoded a 318-bp fragment in which the first 100 bp shared 77% identity with B31 vlsE IR6 (vlsE 880-980) in addition to sequences that shared similarities of identity with 14 fragments within 18940-26270 on B31 linear plasmid 28-1 (lp28-1), where vlsE cassettes are located (11). From this clone, we designed a forward primer within the first 100-bp region (5′-TGATATGAAGAAGAAGGATAAGGTTGCT), a reverse primer that was downstream from this fragment (3′-TGTTGGTAAGAAGGAGGATGTACTAAAA), and an internal probe (GGATTGGCTAAAGATGGGAAGTTTTCGGTTACTAAT). The Q-PCR assay was optimized and all samples were assayed with positive and negative controls, as described previously (23, 24). DNA was extracted from tissues or ticks by use of DNeasy kits (Qiagen, Valencia, CA) according to the manufacturer's instructions for tissue or insects, respectively. Prior to DNA extraction, tissue samples were weighed, snap-frozen in liquid nitrogen, pulverized, and homogenized. Quantitative data were expressed as the number of DNA copies per milligram of tissue or the number of DNA copies per tick.
Serology.
Antibody titers against B. burgdorferi were assayed by enzyme linked immunosorbent assay (ELISA), as described previously (15). Ninety-six-well microtiter plates (Nunc ImmunoMax Maxi-Sorp, Wiesbaden, Germany) were coated with 1 μg/ml B. burgdorferi cN40 lysate in carbonate buffer (pH 9.6) and incubated overnight at 4°C. Coated plates were washed with phosphate-buffered saline-Tween 20 and blocked for 1 h with 1% bovine serum albumin, and then duplicate serial threefold dilutions of serum samples (starting at 1:100 dilution) were added to each well. Plates were again incubated overnight, washed, and then incubated for 2 h with alkaline phosphatase-conjugated rat anti-mouse immunoglobulin (heavy and light chain) diluted 1:5,000. Alkaline phosphatase substrate (Sigma, St. Louis, MO) (1 mg/ml) was then added to each well for color development. Optical density was measured at a test wavelength of 405 nm with an ELISA reader (Molecular Devices Corporation, Sunnyvale, CA). Each assay included positive and negative controls. Cutoff points for each dilution were established by testing absorbance of normal mouse serum samples, determining means, and adding 3 standard deviations above the means.
Histology and immunohistochemistry.
Formalin-fixed rear legs (demineralized in acid) and hearts were paraffin embedded and sectioned at 5 μm. Sections for histology were stained with hematoxylin and eosin. Legs were examined microscopically for evidence of arthritis and synovitis involving the knee and tibiotarsal joints as characterized by examination of infiltration of neutrophils, synovial proliferation, and exudation of fibrin into joint or tendon sheath lumina as well as neutrophil and macrophage infiltration of tissues at the base of the heart (carditis), as described in studies of C3H and C3H-scid mice (1, 4, 5, 8 ). Sections for immunohistochemical labeling of B. burgdorferi were processed using rabbit immune serum diluted 1:1,000 and biotinylated goat anti-rabbit immunoglobulin G (Vector Laboratories, Burlingame, CA), as described previously (7). Sections were randomly numbered and examined under blinded conditions without knowledge of treatment details.
Statistical analysis.
Statistical comparisons between treatment groups and time points were performed, using Student's t test or chi-square analysis. Multiple comparison analyses were performed with one-way analysis of variance followed by a least-difference post hoc test (StatView, PowerPC version; SAS Institute Inc., Cary, NC). Calculated P values lower than 0.05 were considered significant.
Experimental design.
The effectiveness of ceftriaxone or sham treatment was evaluated in mice following treatment that was commenced during the early (3 weeks) or late (4 months) stages of infection. These intervals were chosen to reflect two distinctly different phases of infection in the mouse model. The 3-week interval represented the early stage of infection during which the host immune response is evolving and disease (arthritis and carditis) is at its peak. The 4-month interval represented the persistent phase of infection, when host immunity is fully evolved and disease is resolved (5). Furthermore, spirochetes were sequestered in collagen during the late stage, making them potentially less vulnerable to antibiotic. Mice were subjected to necropsy at 1 and 3 months after completion of the 30-day treatment regimen at these two intervals. Infection status at necropsy was determined by culture and flaB DNA Q-PCR of tissues. In addition, infection status of mice was evaluated by xenodiagnosis, in which larval ticks were allowed to feed on mice several days prior to necropsy. Following feeding, molting, and hardening, nymphal ticks were tested for infection by flaB DNA Q-PCR. An attempt was made to obtain infectious spirochetes in ear tissues of mice by allograft transplantation of pieces of ear pinnae from antibiotic- or saline solution-treated mice into the subcutis of a single naïve C3H mouse. The recipient mice were subjected to necropsy, and tissues (urinary bladder, inoculation site, and quadriceps) were cultured and tested by flaB DNA Q-PCR (ear, inoculation site, heart base, ventricular muscle, tibiotarsus, and quadriceps tissue) at 3 weeks after allograft transplantation.
A confirmatory experiment was performed that examined antibiotic treatment during late infection. Mice were infected for 4 months, treated with antibiotic or saline solution, and then subjected to necropsy at 1 month after completion of treatment. In contrast to the initial study, additional tissue sites, including heart base, urinary bladder, ear, inoculation site, and tibiotarsus, were cultured. An attempt was made to increase the sensitivity of DNA detection using Q-PCR that targeted ospA DNA in lieu of flaB DNA, since ospA has been shown to be overrepresented relative to other targets (target imbalance) in tissue samples (42). PCR was performed using samples from additional tissue sites as well, including the inoculation site, subinoculation site (subcutis), heart base, ventricular muscle, tibiotarsus, quadriceps muscle, and ear. In addition, C3H-scid mice were utilized as recipients of allografts in lieu of C3H mice, and the recipient mice were assessed for infection at 3 weeks after transplant.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
RESULTS Antibiotic treatment during early infection.
When mice were treated with ceftriaxone at 3 weeks of infection and evaluated 1 month after the completion of treatment, none of the tissues from five mice were culture positive, but single tissues from two of five mice were flaB DNA Q-PCR positive (Table 1). One of the PCR-positive mice was also positive by xenodiagnosis, with one of nine ticks positive. None of the allografts transmitted infection to naïve mice, as determined based upon culture or PCR results. In contrast, multiple tissues from all sham-treated mice were culture positive and PCR positive, and all mice were positive by xenodiagnosis. Three of five mouse donors transferred infection by allograft. When mice treated during early infection were evaluated at 3 months after treatment, none of the tissues from three mice were positive by either culture or PCR. One of the three mice was positive by xenodiagnosis, but none of three donors transmitted infection by allograft. In contrast, all four sham-treated mice were positive by culture, PCR, xenodiagnosis, and allograft.
TABLE 1.
Culture, flaB DNA Q-PCR, xenodiagnosis, allograft, and immunohistochemistry results for individual mice treated with ceftriaxone or saline solution during early infection (3 weeks) and subjected to necropsy at 1 or 3 months after completion of treatment (more ...)
Antibiotic treatment during late infection.
When mice were treated with antibiotic at 4 months of infection and evaluated 1 month after completion of treatment, none of the tissues from eight mice were culture positive, but single tissues from all eight mice were flaB DNA Q-PCR positive; three of the eight mice were xenodiagnosis positive, but none transmitted infection by allograft (Table 2). In contrast, four of four sham-treated mice were positive by culture, PCR, xenodiagnosis, and allograft. When mice that were treated during late infection and then evaluated at 3 months after completion of treatment were examined, none of the tissues from five antibiotic-treated mice were culture positive, single tissue samples from two antibiotic-treated mice were PCR positive, two of the mice were positive by xenodiagnosis, and one mouse donor transmitted infection by allograft transplantation. In contrast, all four sham-treated mice were positive by culture, PCR, and xenodiagnosis, but none were positive by allograft. The prevalence of mice that remained positive by one or more indices (culture, PCR, xenodiagnosis) following antibiotic treatment during early versus late infection was significantly higher when mice were treated during late infection (chi-square test; P ≤ 0.05).
TABLE 2.
Culture, flaB DNA Q-PCR, xenodiagnosis, allograft, and immunohistochemistry results for individual mice treated with ceftriaxone or saline solution during late infection (4 months) and subjected to necropsy at 1 or 3 months after completion of treatment (more ...)
Quantitative DNA analysis.
The data in Table 1 and Table 2 summarize positive or negative flaB DNA Q-PCR results, but Q-PCR was also used to quantify spirochete flaB DNA copy numbers in tissues. Minimal numbers of or no flaB copies were detected in tissues of mice treated during early infection compared to the results seen with sham-treated mice. The two positive samples from antibiotic-treated mice contained only 2.5 and 2.7 flaB DNA copies/mg tissue, whereas positive tissues from saline solution-treated mice contained 40.8 ± 69.6 (mean ± standard deviation [SD]) flaB DNA copies/mg tissue. None of the antibiotic-treated mice were PCR positive at 3 months after treatment, but tissues from saline solution-treated mice contained 137.9 ± 176.3 (SD) flaB DNA copies/mg tissue. In contrast, low copy numbers of flaB DNA were detected in multiple tissues following treatment with antibiotic during late infection. Positive samples from mice at 1 month after treatment contained 33.7 ± 60.6 (SD) flaB DNA copies/mg tissue, in contrast to tissues from saline solution-treated mice, which contained a mean of 105.9 ± 285.6 (SD) flaB DNA copies/mg tissue. The two positive tissues from antibiotic-treated mice at 3 months after treatment contained 4.1 and 2.8 flaB DNA copies/mg, in contrast to tissues from saline solution-treated mice (mean, 266.8 ± 309.0 [SD] flaB DNA copies/mg tissue). All tissue samples that were flaB DNA-PCR positive were tested for arp and vlsE and were found to be positive for both arp and vlsE DNA by Q-PCR, thereby confirming the presence of lp28-1 essential genes (see Discussion). Likewise, selected flaB DNA-positive tick samples were also tested and found to be positive for arp and vlsE DNA (data not shown).
Immunohistochemical labeling of persisting spirochetes in tissues.
Immunohistochemistry confirmed the PCR findings and further demonstrated that intact antigen-positive organisms with spirochetal morphology, rather than merely DNA, were present in tissues (Table 1 and Table 2). Heart and tibiotarsal joint tissue sections were examined under blinded conditions for the presence of antigen-expressing spirochetes. Small numbers (one to four per site) of spirochetes could be visualized in collagenous tissues (Fig. (Fig.1)1) of one or more mice in all treatment groups, with the exception of the results seen with mice treated with antibiotic during early infection and examined at 1 month after treatment. Among the antibiotic-treated mice, single spirochetes were typically localized to collagenous tissue of the great vessels at the base of the heart and tendons or ligaments of the joints. Up to four spirochetes were visualized in heart and joint sections of saline solution-treated mice, and they were also occasionally found in the interstitium of the ventricular myocardium of saline solution-treated but not antibiotic-treated mice.
FIG. 1.
Immunohistochemical labeling of multiple B. burgdorferi spirochetes (arrows) in ligament tissue of the tibiotarsal joint of a saline solution-treated (control) mouse (A) and of a single spirochete (arrow) in ligament tissue of the tibiotarsal joint of (more ...)
Serum antibody response to B. burgdorferi following antibiotic treatment.
Serum antibody reactivity to B. burgdorferi was examined in mice following treatment with antibiotic or saline solution. In mice treated with antibiotic during early infection, antibody titers declined compared to saline solution-treated control results (P = 0.004; data not shown). In mice treated with antibiotic at 4 months of infection, antibody titers declined following completion of treatment and continued to decline progressively compared to saline solution-treated control results (Fig. (Fig.2).2). At 3 months following completion of treatment, antibody titers in antibiotic-treated mice were significantly lower than those in saline solution-treated mice (P = 0.0003). Results indicated that maintenance of the antibody response to B. burgdorferi requires active infection with a sufficient spirochete burden in tissues but that the antibody response declines following antibiotic treatment despite the presence of low numbers of spirochetes.
FIG. 2.
B. burgdorferi immunoglobulin G ELISA titers (mean reciprocal dilution ± SD) for mice treated with saline solution or ceftriaxone for 1 month, commencing at 4 months after infection. The dotted box (Rx) indicates the interval of treatment relative (more ...)
Confirmatory experiment with antibiotic treatment during late infection.
As in the previous experiment, tissues from 0 of 10 mice treated with ceftriaxone at 4 months of infection and then subjected to necropsy 1 month after treatment were positive by culture. However, tibiotarsal tissue samples from 9 of 10 mice were positive for ospA in DNA Q-PCR, as was heart base tissue from 8 of 10 mice, but that from other sites was PCR negative, with the exception of a single quadriceps muscle sample (Table 3). In contrast, all tissue sites in all four saline solution-treated mice were culture and PCR positive. The mean ospA DNA values for positive-testing heart base tissues of antibiotic-treated mice were 97 ± 118 (SD) copies/mg tissue compared to 3,495 ± 3,224 (SD) copies in saline solution-treated mice (P = 0.0018). A single tibiotarsal sample from an antibiotic-treated mouse contained 1,060 ospA DNA copies/mg tissue. Excluding that sample, the mean ospA DNA values for the remaining tibiotarsal tissues of antibiotic-treated mice were 24 ± 41 (SD) copies/mg tissue compared to 411 ± 107 (SD) copies in samples from saline solution-treated mice (P = 0.0039). Thus, antibiotic treatment resulted in negative culture results, but spirochetes appeared to survive in low numbers, as determined based on DNA levels.
TABLE 3.
Culture, ospA DNA Q-PCR, and xenodiagnosis results for individual mice treated with ceftriaxone or saline during late infection (4 months) and then examined 1 month after completion of treatment
Xenodiagnosis following antibiotic treatment during late infection.
Ticks were fed on the 10 mice treated with antibiotic and the four saline solution-treated mice in the confirmatory experiment (Table 3). Cohorts of eight nymphal ticks, derived from larvae that fed on each mouse, were evaluated by flaB DNA Q-PCR (except for one saline treated mouse, from which six ticks were tested). Six of 10 antibiotic-treated mice had one or two ticks that were PCR positive among the eight ticks tested. In contrast, all four saline solution-treated mice had three to five positive-testing ticks each. Q-PCR of positive-testing ticks from antibiotic-treated mice revealed a mean of 120.6 ± 75.1 (SD) (range, 28 to 222) flaB DNA copies per tick. In contrast, positive-testing ticks from saline solution-treated mice had a mean of 35,747 ± 40,705 (range, 19 to 151,000) flaB DNA copies per tick (P = 0.0005). An attempt was made to culture spirochetes from cohorts of ticks derived from antibiotic-treated mice that were xenodiagnosis (DNA) positive. Forty-two ticks, representing members of positive-testing cohorts, were cultured, but all were culture negative. In contrast, 5 of 12 ticks among a tick cohort from a single saline solution-treated, xenodiagnosis DNA-positive mouse were culture positive.
Tick-borne transmission of persisting spirochetes from antibiotic-treated mice to SCID mice.
In a further effort to isolate spirochetes from xenodiagnosis DNA-positive ticks from tick pools obtained from the confirmatory experiment, we infested C3H-scid mice with eight nymphal ticks from cohorts of ticks derived from xenodiagnosis DNA-positive C3H mice. Based upon results of culture of urinary bladder, inoculation site, and quadriceps muscle tissue at 3 weeks after feeding, 0 of 10 C3H-scid mice became infected following feeding by ticks from antibiotic-treated mice, in contrast to four of four mice that became infected following infestation with ticks derived from saline solution-treated mice.
In an effort to extend these findings, each of nine C3H-scid mice was infested with 15 to 20 nymphal ticks from xenodiagnosis DNA-positive cohorts of ticks derived from mice that were treated with antibiotics (Table 4). In order to verify that the SCID mice were actually exposed to DNA-positive ticks, the infection status of each of the ticks that were used to feed upon the SCID mice was determined by flaB Q-PCR after ticks fed to repletion, molted, and hardened. The infection status of the SCID mice was assessed by culture of urinary bladder, ear, and inoculation site tissue and by flaB DNA Q-PCR of ear, subinoculation site, heart base, and tibiotarsus tissue. Mice were subjected to necropsy at 3 weeks after tick feeding. With the exception of one ear sample, all sites were culture negative. The exception was a culture tube that contained a single nonmotile spirochete. In contrast, flaB Q-PCR results indicated that one or more tissue samples from eight of nine SCID mice were positive. Copy numbers were generally low, ranging from as few as 2.8 flaB DNA copies/mg tissue to as many as 50,500/mg tissue (excluding the 50,500/mg value, the mean was 656.2 flaB DNA copies/mg ± 1,175.1 [SD]). Thus, it appeared that C3H-scid mice supported somewhat higher populations of spirochetes than C3H mice, and yet we were unable to culture spirochetes from tissues. Finally, joints (knees and tibiotarsi) and hearts of the SCID mice were examined for histopathology. None of the SCID mouse tissues showed microscopic evidence of inflammation despite the high prevalence of B. burgdorferi ospA DNA in hearts and joints and the propensity of infected C3H-scid mice to develop progressive severe inflammation (8 ).
TABLE 4.
flaB DNA QT-PCR, PCR, and culture results for individual SCID mice at 3 weeks following feeding by ticks that fed upon mice treated with antibiotic during late infection (4 months)
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
DISCUSSION The present report extends and amends the findings of Bockenstedt et al. (9), who concluded that antibiotic treatment resulted in persistence of attenuated, noninfectious spirochetes that could be acquired by ticks (xenodiagnosis) but that infected ticks could not transmit infection to naïve hosts. The data in the present report differ from those conclusions in that antibiotic treatment resulted in persistence of low numbers of spirochetes in tissues of treated mice and that ticks could both acquire and transmit infectious spirochetes. Thus, results of the current study indicate that persisting spirochetes retain their infectivity, albeit at a low level. Quantitative PCR results indicate that very low copy numbers of spirochetal DNA were present in tissues from treated mice, as well as in ticks that acquired infection from treated mice. Normally, there is a burst of spirochetal replication in ticks following feeding, with a net increase in DNA copy numbers (24). This was not seen in ticks that fed on antibiotic-treated mice, in contrast to ticks that fed on saline solution-treated control mice. Notably, C3H-scid mice developed disseminated infections when fed on by ticks infected with spirochetes from antibiotic-treated mice, but spirochetes could not be cultured from the C3H-scid mice, and DNA copy numbers in tissues were generally low. These results support the notion that spirochetes were infectious but were altered in their ability to replicate even in globally immunodeficient hosts.
Because these conclusions are based upon DNA amplification, it could be argued that results do not absolutely prove the presence of live spirochetes. However, it has been shown that B. burgdorferi DNA does not persist in tissues unless live spirochetes are present (32, 42). We attempted to isolate spirochetes in order to characterize their plasmid content, but this was prevented by the inability of spirochetes to replicate in culture, despite the sensitivity of our culture method for detecting low numbers of spirochetes. This result was reinforced by the finding of a culture from an antibiotic-treated tick-infected C3H-scid mouse that contained a single nonmotile spirochete. In addition, the low levels of spirochetal DNA precluded detection of RNA transcription despite attempts to amplify cDNA (data not shown). We therefore undertook an exhaustive search for morphologically intact, antigen-expressing spirochetes in tissues by immunohistochemistry. There is increasing evidence that collagen is a critical niche for spirochete survival and possibly immune evasion (7, 30). We have found that vessels at the base of the heart and in ligaments and tendons of the tibiotarsal region (as well as in other joint tissues) are collagen-rich preferential regions for spirochetes in the persistent phase of infection (7). When these sites were examined by immunohistochemistry in the present study, low numbers of spirochetes were visualized in collagenous tissues of both antibiotic- and saline solution-treated mice. In C3H-scid mice infected with ticks from antibiotic-treated mice, the heart base and tibiotarsus tissues were also consistently positive by PCR. These findings support the idea of the viability of spirochetes following antibiotic treatment and further incriminate collagen as a preferential site of persistence that may contribute to antibiotic treatment failure. A study in which mice were treated with ceftriaxone for only 5 days resulted in similar findings, with detection of persisting spirochetal DNA in joint tissue (70). Persistence of Borrelia burgdorferi following antibiotic treatment of human patients in studies investigating collagenous tissue, including ligamentous tissue (21), synovium tissue (47), and skin tissue (25, 45), has also been documented.
The study by Bockenstedt et al. (9) utilized standard PCR to determine whether critical infectivity-associated plasmids or genes were present to explain the attenuation of spirochetes. The presence of lp25 of B. burgdorferi B31 has been shown to be essential for infectivity (49). The essential component has been defined as a single gene on lp25 that encodes a nicotinamidase (48 ). In addition, it appears that determinants encoded on lp28-1 of B. burgdorferi B31 affect relative infectivity (27, 28, 49). The lp28-1 plasmid of B. burgdorferi B31 encodes two functional genes, vlsE and arp (p37-47) in addition to a number of paralogous genes that are encoded on other plasmids or chromosomes, pseudogenes, genes with frame shift mutations, or sequences that encode products that are consist of fewer than 100 amino acids (16). Bockenstedt et al. (9) used standard PCR to evaluate the presence of BBE21.1, which is specific for lp25, and arp (p37-47), which is specific for lp28-1, and were unable to consistently amplify these targets in infected ticks that fed on antibiotic-treated mice. We tested DNA from three flaB DNA-positive ticks that fed on antibiotic-treated mice for the lp25 target and confirmed its presence. Since lp25 appears to be absolutely essential for infectivity and since our studies demonstrated the presence of infectivity, we focused on lp28-1 targets vlsE and arp. When B. burgdorferi N40-specific primers were used, both targets were present in all flaB DNA-positive samples tested by Q-PCR. It should be noted that the B. burgdorferi N40 genome is configured differently from the B. burgdorferi B31 genome and that vlsE and arp appear to be located on separate plasmids in B. burgdorferi N40 (S. Casjens, unpublished observations). Thus, using Q-PCR, which is more sensitive than standard PCR, we found no evidence of missing vlsE or arp. Loss of other plasmids has also been associated with diminished infectivity (33, 53, 68 ). Although we did not survey the entire genome, we found no evidence of spirochetes missing the critical infectivity-related genes that are homologous to B. burgdorferi B31 lp25 and lp28-1 in tissue samples from either mice or ticks.
There are a number of possible variables that may have influenced persistence of spirochetes in tissues following ceftriaxone treatment in this study. B. burgdorferi N40 has been shown to differ from other B. burgdorferi strains by being resistant to erythromycin compared to B. burgdorferi strains B31 and 297 (64), but B. burgdorferi N40 is as susceptible as B. burgdorferi B31 to ceftriaxone, as determined based upon MIC/MBC analysis in this study and by others (37, 55). Furthermore, serum levels of ceftriaxone in treated mice were well above the MIC/MBC. Nevertheless, the pharmacokinetics of ceftriaxone in mice differ from that of humans, as the trough levels in serum of treated humans are approximately 15 μg/ml at 24 h (43), whereas they were undetectable in mice at 8 h. Thus, the treatment regimen used for the mice, albeit long term, created a pulsed-dose effect. Studies with Enterococcus faecalis have shown that pulsed doses of penicillin resulted in development of bacterial tolerance to antibiotic without changes in resistance, whereas continuous treatment did not (22). Ceftriaxone binds to carboxypeptidases, endopeptidases, and transpeptidases in the cytoplasmic membrane and thereby inhibits cell wall synthesis and cell division (26). Spirochetes within collagen, especially in the persistent phase of infection, may be in a metabolically dormant (nondividing) state, with minimal cell wall synthesis, and this may affect levels of tolerance of ceftriaxone. Similar ?persister cells? have been documented in a variety of bacterial infections (29, 54). Our findings parallel those of Straubinger et al. (59, 61, 62), who noted that cultures were uniformly negative in PCR-positive tissues from antibiotic-treated dogs in spite of the fact that culture assays were typically more sensitive than PCR for detection of B. burgdorferi in tissues of untreated dogs. These results fit with the concept of persister cells that evade killing by antibiotics. Further studies are needed to determine whether persisting B. burgdorferi spirochetes can revert to a dividing, pathogenic state.
The current study indicated that accessible indices of treatment, such as culture or PCR of skin and serologic response, cannot be relied upon as markers for treatment success. A declining antibody response, as has been noted following antibiotic treatment in mice (9) as well as in antibiotic-treated dogs (61), occurs despite low levels of persisting spirochetes. Our results show that spirochetes are viable and transmissible and express antigen (based upon immunohistochemistry results) following antibiotic treatment, particularly when commenced during the late stage of infection. However, the few residual spirochetes appeared to be altered in their ability to replicate, and this may explain the lack of inflammation that we noted in SCID mouse tissues. Although overt disease may not be present, the continued expression of lipoproteins by B. burgdorferi may contribute to persistence of constitutional symptoms. Spirochetal lipoproteins have been shown to potently elicit a wide variety of proinflammatory responses (12, 13, 18, 19, 31, 36, 39, 40, 50, 57, 63, 65, 66, 69). This may explain the slow recovery period (termed ?post-Lyme disease syndrome?) that has been noted following antibiotic treatment of patients (67). Further studies are needed to determine the eventual fate of the persisting organisms following antibiotic treatment in the context of controlled animal studies.
AcknowledgmentsThis work was supported by Public Health Service grant AI-26815 from the National Institute of Allergy and Infectious Diseases.
The authors are indebted to Gary Wormser for editorial comments and to Durland Fish for provision of ticks used in this study.
FootnotesPublished ahead of print on 3 March 2008.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
REFERENCES1. Armstrong, A. L., S. W. Barthold, D. H. Persing, and D. S. Beck. 1992. Carditis in Lyme disease susceptible and resistant strains of laboratory mice infected with Borrelia burgdorferi. Am. J. Trop. Med. Hyg. 47:249-258. [PubMed]
2. Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57:521-525. [PubMed]
3. Barthold, S. W. 1993. Antigenic stability of Borrelia burgdorferi during chronic infections of immunocompetent mice. Infect. Immun. 61:4955-4961. [PubMed]
4. Barthold, S. W. 1996. Lyme borreliosis in the laboratory mouse. J. Tick-Borne Spirochetal Dis. 3:22-44.
5. Barthold, S. W., M. S. de Souza, J. L. Janotka, A. L. Smith, and D. H. Persing. 1993. Chronic Lyme borreliosis in the laboratory mouse. Am. J. Pathol. 143:951-971.
6. Barthold, S. W., E. Fikrig, L. K. Bockenstedt, and D. H. Persing. 1995. Circumvention of outer surface protein A immunity by host-adapted Borrelia burgdorferi. Infect. Immun. 63:2255-2261. [PubMed]
7. Barthold, S. W., E. Hodzic, S. Tunev, and S. Feng. 2006. Antibody-mediated disease remission in the mouse model of Lyme borreliosis. Infect. Immun. 74:4817-4825. [PubMed]
8. Barthold, S. W., C. L. Sidman, and A. L. Smith. 1992. Lyme borreliosis in genetically resistant and susceptible mice with severe combined immunodeficiency. Am. J. Trop. Med. Hyg. 47:605-613. [PubMed]
9. Bockenstedt, L. K., J. Mao, E. Hodzic, S. W. Barthold, and D. Fish. 2002. Detection of attenuated, non-infectious spirochetes after antibiotic treatment of Borrelia burgdorferi-infected mice. J. Infect. Dis. 186:1430-1437. [PubMed]
10. Bradley, J. F., R. C. Johnson, and J. L. Goodman. 1994. The persistence of spirochetal nucleic acids in active Lyme arthritis. Ann. Int. Med. 120:487-489. [PubMed]
11. Casjens, S., N. Palmer, R. vanVugt, W. M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, and C. M. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490-516. [PubMed]
12. de Souza, M. S., E. Fikrig, A. L. Smith, R. A. Flavell, and S. W. Barthold. 1992. Nonspecific proliferative responses of murine lymphocytes to Borrelia burgdorferi antigens. J. Infect. Dis. 165:471-478. [PubMed]
13. Ebnet, K., K. D. Brown, U. K. Siebenlist, M. M. Simon, and S. Shaw. 1997. Borrelia burgdorferi activates nuclear factor-KB and is a potent inducer of chemokine and adhesion molecule gene expression in endothelial cells and fibroblasts. J. Immunol. 158:3285-3292. [PubMed]
14. Feng, S., E. Hodzic, and S. W. Barthold. 2000. Lyme arthritis resolution with antiserum to a 37-kilodalton Borrelia burgdorferi protein. Infect. Immun. 68:4169-4173. [PubMed]
15. Feng, S., E. Hodzic, B. Stevenson, and S. W. Barthold. 1998. Humoral immunity to Borrelia burgdorferi N40 decorin binding proteins during infection of laboratory mice. Infect. Immun. 66:2827-2835. [PubMed]
16. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. vanVugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586. [PubMed]
17. Fraser, D. D., L. I. King, and F. W. Miller. 1992. Molecular detection of persistent Borrelia burgdorferi in a man with dermatomyositis. Clin. Exp. Rheumatol. 10:387-390. [PubMed]
18. Giambartolomei, G. H., V. A. Dennis, B. L. Lasater, and M. T. Philipp. 1999. Induction of pro- and anti-inflammatory cytokines by Borrelia burgdorferi lipoproteins in monocytes is mediated by CD14. Infect. Immun. 67:140-147. [PubMed]
19. Giambartolomei, G. H., V. A. Dennis, and M. T. Philipp. 1998. Borrelia burgdorferi stimulates the production of interleukin-10 in peripheral blood mononuclear cells from uninfected humans and rhesus monkeys. Infect. Immun. 66:2691-2697. [PubMed]
20. Goodman, J. L., P. Jurkovich, C. Kodner, and R. C. Johnson. 1991. Persistent cardiac and urinary tract infections with Borrelia burgdorferi in experimentally infected Syrian hamsters. J. Clin. Microbiol. 29:894-896. [PubMed]
21. Häupl, T., G. Hahn, M. Rittig, A. Krause, C. Schoerner, U. Schonherr, J. R. Kalden, and G. R. Burmester. 1993. Persistence of Borrelia burgdorferi in ligamentous tissue from a patient with chronic Lyme borreliosis. Arthritis Rheum. 36:1621-1626. [PubMed]
22. Hodgess, T. L., S. Zighelboim-Daum, G. M. Eliopoulos, C. Wennersten, and R. C. Moellering, Jr. 1992. Antimicrobial susceptibility changes in Enterococcus faecalis following various penicillin exposure regimens. Antimicrob. Agents Chemother. 36:121-125. [PubMed]
23. Hodzic, E., S. Feng, K. Freet, and S. W. Barthold. 2003. Borrelia burgdorferi population dynamics and prototype gene expression during infection of immunocompetent and immunodeficient mice. Infect. Immun. 71:5042-5055. [PubMed]
24. Hodzic, E., S. Feng, K. J. Freet, D. L. Borjesson, and S. W. Barthold. 2002. Borrelia burgdorferi population kinetics and selected gene expression at the host-vector interface. Infect. Immun. 70:3382-3388. [PubMed]
25. Hudson, B. J., M. Stewart, V. A. Lennox, M. Fukunaga, M. Yabuki, H. Macorison, and J. Kitchener-Smith. 1998. Culture-positive Lyme borreliosis. Med. J. Aust. 168:500-502. [PubMed]
26. Klein, N. C., and B. A. Cunha. 1995. Third-generation cephalosporins. Med. Clin. N. Am. 79:705-719. [PubMed]
27. Labandeira-Rey, M., J. Seshu, and J. Skare. 2003. The absence of linear plasmid 25 or 28-1 of Borrelia burgdorferi dramatically alters the kinetics of experimental infection via distinct mechanisms. Infect. Immun. 71:4608-4613. [PubMed]
28. Labandeira-Rey, M., and J. T. Skare. 2001. Decreased infectivity in Borrelia burgdorferi strain B31 is associated with loss of linear plasmid 25 or 28-1. Infect. Immun. 69:446-455. [PubMed]
29. Lewis, K. 2007. Persister cells, dormancy and infectious disease. Nat. Rev. Microbiol. 5:48-56. [PubMed]
30. Liang, F. T., E. L. Brown, T. Wang, R. V. Iozzo, and E. Fikrig. 2004. Protective niche for Borrelia burgdorferi to evade humoral immunity. Amer. J. Pathol. 165:977-985. [PubMed]
31. Ma, Y., K. P. Seiler, K.-F. Tai, L. Yang, M. Woods, and J. J. Weis. 1994. Outer surface lipoproteins of Borrelia burgdorferi stimulate nitric oxide production by the cytokine-inducible pathway. Infect. Immun. 62:3663-3671. [PubMed]
32. Malawista, S. M., S. W. Barthold, and D. H. Persing. 1994. Fate of Borrelia burgdorferi DNA in tissues of infected mice after antibiotic treatment. J. Infect. Dis. 170:1312-1316. [PubMed]
33. McDowell, J. V., S. Y. Sung, M. Labandeira-Rey, J. T. Skare, and R. T. Marconi. 2001. Analysis of mechanisms associated with loss of infectivity of clonal populations of Borrelia burgdorferi B31MI. Infect. Immun. 69:3670-3677. [PubMed]
34. Moody, K. D., R. L. Adams, and S. W. Barthold. 1994. Effectiveness of antimicrobial treatment against Borrelia burgdorferi infection in mice. Antimicrob. Agents Chemother. 38:1567-1572. [PubMed]
35. Moody, K. D., S. W. Barthold, G. A. Terwilliger, D. S. Beck, G. M. Hansen, and R. O. Jacoby. 1990. Experimental chronic Lyme borreliosis in Lewis rats. Am. J. Trop. Med. Hyg. 42:165-174. [PubMed]
36. Morrison, T. B., J. H. Weis, and J. J. Weis. 1997. Borrelia burgdorferi outer surface protein A (OspA) activates and primes human neutrophils. J. Immunol. 158:4838-4845. [PubMed]
37. Murgia, R., F. Marchetti, and M. Cinco. 1999. Comparative bacteriostatic and bacteriocidal activities of cefodinzine against Borrelia burgdorferi sensu lato. Antimicrob. Agents Chemother. 43:3030-3032. [PubMed]
38. Nocton, J. J., F. Dressler, R. J. Rutledge, P. N. Rys, D. H. Persing, and A. C. Steere. 1994. Detection of Borrelia burgdorferi DNA by polymerase chain reaction in synovial fluid from patients with Lyme arthritis. N. Engl. J. Med. 330:229-234. [PubMed]
39. Norgard, M., B. Riley, J. Richardson, and J. Radolf. 1995. Dermal inflammation elicited by synthetic analogs of Treponema pallidum and Borrelia burgdorferi lipoproteins. Infect. Immun. 63:1507-1515. [PubMed]
40. Norgard, M. V., L. L. Arndt, D. R. Akins, L. L. Curetty, D. A. Harrich, and J. D. Radolf. 1996. Activation of human monocytic cells by Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides proceeds via a pathway distinct from that of lipopolysaccharide but involves the transcriptional activator NF-κB. Infect. Immun. 64:3845-3852. [PubMed]
41. Oksi, J., M. Marjamaki, J. Nikoskelainen, and M. K. Viljanen. 1999. Borrelia burgdorferi detected by culture and PCR in clinical relapse of disseminated Lyme borreliosis. Ann. Med. 31:225-232. [PubMed]
42. Persing, D. H., B. J. Rutledge, P. N. Rys, D. S. Podzorski, P. D. Mitchell, K. D. Reed, B. Liu, E. Fikrig, and S. E. Malawista. 1994. Target imbalance: disparity of Borrelia burgdorferi genetic material in synovial fluid from Lyme arthritis patients. J. Infect. Dis. 169:668-672. [PubMed]
43. Pollock, A. A., P. E. Tee, I. H. Patel, J. Spicehandler, M. S. Simberkoff, and J. J. Rahal, Jr. 1982. Pharmacokinetic characteristics of intravenous ceftriaxone in normal adults. Antimicrob. Agents Chemother. 22:816-823. [PubMed]
44. Preac Mursic, V., E. Patsouris, B. Wilske, S. Reinhardt, B. Gos, and P. Mehraein. 1990. Persistence of Borrelia burgdorferi and histopathological alterations in experimentally infected animals; comparison with histopathological findings in human Lyme disease. Infection 18:332-341. [PubMed]
45. Preac Mursic, V., H. W. Pfister, B. Wilske, B. Gross, A. Baumann, and J. Prokop. 1989. Survival of Borrelia burgdorferi in antibiotically treated patients with Lyme borreliosis. Infection 17:355-359. [PubMed]
46. Preac Mursic, V., B. Wilske, G. Schierz, H. W. Pfister, and K. Einhaupl. 1984. Repeated isolation of spirochetes from the cerebrospinal fluid of a patient with meningoradiculitis Bannwarth. Eur. J. Clin. Microbiol. 3:564-565. [PubMed]
47. Priem, S., G. R. Burmester, T. Kamradt, K. Wolbart, M. G. Rittig, and A. Krause. 1998. Detection of Borrelia burgdorferi by polymerase chain reaction in synovial membrane, but not in synovial fluid from patients with persisting Lyme arthritis after antibiotic therapy. Ann. Rheum Dis. 57:118-121. [PubMed]
48. Purser, J. E., M. B. Lawrenz, M. J. Caimano, J. K. Howell, J. D. Radolf, and S. J. Norris. 2003. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host. Mol. Microbiol. 48:753-764. [PubMed]
49. Purser, J. E., and S. J. Norris. 2000. Correlation between plasmid content and infectivity of Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:13865-13870. [PubMed]
50. Radolf, J. D., L. L. Arndt, D. R. Akins, L. L. Curetty, M. E. Levi, Y. N. Shen, L. S. Davis, and M. V. Norgard. 1995. Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides activate monocytes/macrophages. J. Immunol. 154:2866-2877. [PubMed]
51. Roberts, E. D., R. F. Bohm, F. B. Cogswell, H. N. Lanners, R. C. Lowrie, L. Povinelli, J. Piesman, and M. T. Philipp. 1995. Chronic Lyme disease in the rhesus monkey. Lab. Investig. 72:146-160. [PubMed]
52. Schmidli, J., T. Hunziker, P. Moesli, and U. B. Schaad. 1988. Cultivation of Borrelia burgdorferi from joint fluid three months after treatment of facial palsy due to Lyme borreliosis. J. Infect. Dis. 158:905-906. [PubMed]
53. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect. Immun. 56:1831-1836. [PubMed]
54. Shah, D., Z. Zhang, A. Khodursky, N. Kaldalu, K. Kurg, and K. Lewis. 2006. Persisters: a distinct physiologic state of E. coli. BMC Microbiol. 6:53-61. [PubMed]
55. Sicklinger, M., R. Wienecke, and U. Neubert. 2003. In vitro susceptibility testing of four antibiotics against Borrelia burgdorferi: a comparison of results for the three genospecies Borrelia afzelii, Borrelia garinii, and Borrelia burgdorferi sensu stricto. J. Clin. Microbiol. 41:1791-1793. [PubMed]
56. Snydman, D. R., D. P. Schenkein, V. P. Berardi, C. C. Lastavica, and K. M. Pariser. 1986. Borrelia burgdorferi in joint fluid in chronic Lyme arthritis. Ann. Int. Med. 104:798-800. [PubMed]
57. Sobek, V., N. Birkner, I. Falk, A. Wurch, C. J. Kirschning, H. Wagner, R. Wallich, M. C. Lamers, and M. M. Simon. 2004. Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease. Arthritis Res. Ther. 6:R433-R446. [PubMed]
58. Stanek, G., J. Klein, R. Bittner, and D. Glogar. 1990. Isolation of Borrelia burgdorferi from the myocardium of a patient with longstanding cardiomyopathy. N. Engl. J. Med. 322:249-252. [PubMed]
59. Straubinger, R. K. 2000. PCR-based quantification of Borrelia burgdorferi organisms in canine tissue over a 500-day postinfection period. J. Clin. Microbiol. 38:2191-2199. [PubMed]
60. Straubinger, R. K., A. F. Straubinger, B. A. Summers, H. N. Erb, L. Harter, and M. J. G. Appel. 1998. Borrelia burgdorferi induces the production and release of proinflammatory cytokines in canine synovial explant cultures. Infect. Immun. 66:247-258. [PubMed]
61. Straubinger, R. K., A. F. Straubinger, B. A. Summers, and R. H. Jacobson. 2000. Status of Borrelia burgdorferi infection after antibiotic treatment and the effects of corticosteroids: an experimental study. J. Infect. Dis. 181:1069-1081. [PubMed]
62. Straubinger, R. K., B. A. Summers, Y. F. Chang, and M. J. G. Appel. 1997. Persistence of Borrelia burgdorferi in experimentally infected dogs after antibiotic treatment. J. Clin. Microbiol. 35:111-116. [PubMed]
63. Tai, K. F., Y. Ma, and J. J. Weis. 1994. Normal human B lymphocytes and mononuclear cells respond to the mitogenic and cytokine-stimulatory activities of Borrelia burgdorferi and its lipoprotein OspA. Infect. Immun. 62:520-528. [PubMed]
64. Terekhova, D., M. L. Sartakova, G. P. Wormser, I. Schwartz, and F. C. Cabello. 2002. Erythromycin resistance in Borrelia burgdorferi. Antimicrob. Agents Chemother. 46:3637-3640. [PubMed]
65. Weis, J. J., Y. Ma, and L. F. Erdile. 1994. Biological activities of native and recombinant Borrelia burgdorferi outer surface protein A: dependence on lipid modification. Infect. Immun. 62:4632-4636. [PubMed]
66. Wooten, R. M., V. R. Modur, T. M. McIntyre, and J. J. Weis. 1996. Borrelia burgdorferi outer membrane protein A induces nuclear translocation of nuclear factor-kappa B and inflammatory activation in human endothelial cells. J. Immunol. 157:4584-4590. [PubMed]
67. Wormser, G. P., R. J. Dattwyler, E. D. Shapiro, J. J. Halperin, A. C. Steere, M. S. Klempner, P. J. Krause, J. S. Bakken, F. Strle, G. Stanek, L. Bockenstedt, D. Fish, J. S. Dumler, and R. B. Nadelman. 2006. The clinical assessment, treatment, and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: clinical practice guidelines by the Infectious Diseases Society of America. Clin. Infect. Dis. 43:1089-1134. [PubMed]
68. Xu, Y. N., C. Kodner, L. Coleman, and R. C. Johnson. 1996. Correlation of plasmids with infectivity of Borrelia burgdorferi sensu stricto type strain B31. Infect. Immun. 64:3870-3876. [PubMed]
69. Yang, L. M., Y. Ma, R. Schoenfeld, M. Griffiths, E. Eichwald, B. Aranco, and J. J. Weis. 1992. Evidence for lymphocyte-B mitogen activity in Borrelia burgdorferi-infected mice. Infect. Immun. 60:3033-3041. [PubMed]
70. Yrjänäinen, H., J. Hyotenen, S. R. Song, J. Oksi, K. Hartiala, and M. K. Viljanen. 2007. Anti-tumor necrosis factor-alpha treatment activates Borrelia burgdorferi spirochetes in 4 weeks after ceftriaxone treatment in C3H/He mice. J. Infect. Dis. 195:1489-1496. [PubMed]
Osalle hiiristä annettiin kuukauden antibioottihoito (keftriaksoni), osalle keittosuolaliuosta. Antibioottihoitoa saaneiden hiirten vasta-ainetestit olivat negatiiviset, MUTTA kudoksista tehty DNA-testi (PCR) oli positiivinen ja bakteeria löydettiin kollageenia sisältävistä kudoksista.
Persistence of Borrelia burgdorferi following Antibiotic Treatment in Mice
Antimicrob Agents Chemother. 2008 May; 52(5): 1728?1736.
Published online 2008 March 3. doi: 10.1128/AAC.01050-07. PMCID: PMC2346637
Copyright © 2008, American Society for Microbiology
Persistence of Borrelia burgdorferi following Antibiotic Treatment in Mice
Emir Hodzic, Sunlian Feng, Kevin Holden, Kimberly J. Freet, and Stephen W. Barthold*
Center for Comparative Medicine, Schools of Medicine and Veterinary Medicine, University of California at Davis, One Shields Avenue, Davis, California 95616
*Corresponding author. Mailing address: Center for Comparative Medicine, Schools of Medicine and Veterinary Medicine, University of California at Davis, One Shields Avenue, Davis, CA 95616. Phone: (530) 758-4964. Fax: (530) 758-7914. E-mail: swbarthold@ucdavis.edu
Received August 9, 2007; Revised November 1, 2007; Accepted December 26, 2007.
This article has been cited by other articles in PMC.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES AbstractThe effectiveness of antibiotic treatment was examined in a mouse model of Lyme borreliosis. Mice were treated with ceftriaxone or saline solution for 1 month, commencing during the early (3 weeks) or chronic (4 months) stages of infection with Borrelia burgdorferi. Tissues from mice were tested for infection by culture, PCR, xenodiagnosis, and transplantation of allografts at 1 and 3 months after completion of treatment. In addition, tissues were examined for the presence of spirochetes by immunohistochemistry.
In contrast to saline solution-treated mice, mice treated with antibiotic were consistently culture negative, but tissues from some of the mice remained PCR positive, and spirochetes could be visualized in collagen-rich tissues.
Furthermore, when some of the antibiotic-treated mice were fed on by Ixodes scapularis ticks (xenodiagnosis), spirochetes were acquired by the ticks, as determined based upon PCR results, and ticks from those cohorts transmitted spirochetes to naïve SCID mice, which became PCR positive but culture negative.
Results indicated that following antibiotic treatment, mice remained infected with nondividing but infectious spirochetes, particularly when antibiotic treatment was commenced during the chronic stage of infection.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES Lyme borreliosis is a multisystem disorder that arises from tick-transmitted infection with Borrelia burgdorferi. When infection is left untreated, B. burgdorferi can effectively evade host immune clearance, resulting in persistent infection that may or may not be manifested as clinical disease. Experimental studies of a wide variety of laboratory animals (mice [5], rats [35], hamsters [20], gerbils [44], dogs [62], and nonhuman primates [51]) indicate that persistent infection is the norm in fully immunocompetent hosts. There is some direct (culture) and indirect (DNA amplification) evidence for persistence in human cases as well (10, 17, 21, 23, 25, 38, 41, 45, 46, 47, 52, 56, 58 ).
The laboratory mouse is employed in extensively utilized models for Lyme borreliosis research. Mice develop many of the common manifestations of Lyme disease in humans, including arthritis, synovitis, carditis, myositis, and peripheral neuritis, but not the central nervous system disease or chronic unremitting arthritis that may occur in some human patients. In addition, the murine immune response to infection closely parallels that of humans (4). Studies of mice have revealed that spirochete numbers in tissues are highest during the early stage of infection and decline with the evolution of the host immune response (23). The evolution of host immunity results in global reduction of spirochete numbers in many tissues but fails to clear infection. In the persistent stage of infection, spirochetes are sequestered within highly collagenous areas of vessel walls, ligaments, and tendons. Spirochetes are also intercalated within collagen of the dermis, where ticks can acquire infection by feeding upon persistently infected mice (7). Evidence exists for persistence of spirochetes after antibiotic therapy in dogs, but the absence of clinical sequelae or culture positivity has raised questions about spirochete pathogenicity and viability (60, 61). Likewise, persisting B. burgdorferi infections in the ligamentous tissue (21), synovium (47), and skin (25, 45) of human patients following treatment with antibiotics have been documented.
In a study involving mice treated for 30 days with ceftriaxone or doxycycline, persistent infection was documented by detection of low levels of spirochetal DNA in tissues for up to 9 months and by feeding ticks upon the mice and then testing the ticks for spirochetes (xenodiagnosis). Infection could be detected by xenodiagnosis for up to 3 months after antibiotic treatment. Efforts to transmit infection to naïve mice from the infected ticks that fed on antibiotic-treated mice were not successful. Examination of the spirochetal DNA within positive-testing ticks suggested that the spirochetes had possibly lost genes or plasmids that were crucial for infectivity. It has been suggested that persisting spirochetes are attenuated and noninfectious (9). In another study using short-term ceftriaxone or ampicillin treatment in mice, spirochetal DNA could be detected in joint tissue but not in other tissues at 4 weeks after antibiotic treatment, but viable spirochetes could not be cultured (70). These results parallel those determined in studies of dogs treated with azithromycin, doxycycline, or ceftriaxone (61). The inability to culture spirochetes from DNA-positive tissues or to transmit spirochetes from infected ticks that fed on antibiotic-treated mice may be due to attenuation of spirochetes by antibiotics, as has been suggested, or may be due to the presence of a subpopulation of antibiotic-tolerant, nondividing ?persister? bacteria (37, 55).
The current study further investigated the issue of B. burgdorferi persistence following antibiotic therapy by examining mice treated with ceftriaxone during the early stage of infection compared to mice treated during the late stage of infection. A recent study has shown that there are significant shifts into or preferential survival of spirochetes in collagen during chronic infection (7), which may facilitate immune evasion and impact effectiveness of antibiotics.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES MATERIALS AND METHODSMice.
Three- to 5-week-old female C3H/HeN (C3H) specific-pathogen-free mice were purchased from the Frederick Cancer Research Center, Frederick, MD, and C3H.C-PrkdcscidIcrSmnHsd (C3H-scid, or SCID) mice were purchased from Harlan Sprague-Dawley, Inc., Indianapolis, IN. Mice were maintained in an isolation room within filter-top cages and were provided food and water ad libitum. Immediately prior to B. burgdorferi inoculation of mice and every month following inoculation, blood samples were obtained from their caudal veins. To detect the presence of infectious spirochetes in tissues following antibiotic or sham treatment, the distal ear pinnae were collected aseptically at necropsy and then transplanted through a pocket watch incision into the subcutis of naïve C3H or C3H-scid mice, as described previously (3, 6). Mice were subjected to necropsy following carbon dioxide narcosis and exsanguination by cardiocentesis. All experiments were approved by the University of California at Davis (UCD) Institutional Animal Care and Use Committee. The University of California at Davis is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International.
Borrelia burgdorferi.
A low-passage-number clonal strain of B. burgdorferi N40 (cN40) sensu stricto was grown in modified Barbour-Stoenner-Kelly (BSKII) medium, as described previously (2). Mice were infected by subdermal inoculation of 104 mid-log-phase spirochetes in 0.1 ml of BSKII medium on the dorsal thoracic midline. The infection status of mice was assessed by culture of inoculation site, urinary bladder, and quadriceps muscle tissue, as previously described (5). Infection was also assessed by PCR amplification of B. burgdorferi target genes in samples of ear, skin, heart base, ventricular muscle, tibiotarsal joint, and quadriceps muscle tissue (see below). The sensitivity of BSKII medium for detection of viable spirochetes was verified by serial 10-fold dilutions of a B. burgdorferi N40 culture. Triplicate cultures were inoculated with 105, 104, 103, 102, 101, 100, and 10−1 dilutions of spirochetes and examined for growth at 5 and 12 days. Spirochete growth occurred at all dilutions through 100, indicating the high degree of sensitivity of spirochete growth in BSKII medium.
Antibiotic.
Mice were treated with 16 mg/kg ceftriaxone in a 500-μl total volume of 0.9% normal saline solution administered intraperitoneally twice daily for 5 days and then once daily for 25 days. Sham-treated mice received a similar volume of saline solution. This dose has been previously shown to reach effective serum concentrations in mice following subcutaneous injection (9, 34). Serum ceftriaxone levels were evaluated in mice injected intraperitoneally with 16 mg/kg ceftriaxone-500 μl of saline solution and bled at 0, 1, 2, 4, 8, 12, and 24 h after treatment. Serum ceftriaxone levels were measured in triplicate 20-μl samples by use of an agar-based Staphylococcus aureus (ATCC 25923) inhibition assay, as described previously (34). Serum levels of ceftriaxone were 93 μg/ml, 20 μg/ml, and 2 μg/ml at 1, 2, and 4 h, respectively. No inhibition was detectable at 8 h or thereafter. These serum levels of ceftriaxone exceeded those measured in previous studies of mice given 16 mg/kg ceftriaxone subcutaneously (9, 34) and of dogs administered 25 mg/kg ceftriaxone intravenously (61).
The MIC and minimum bactericidal concentration (MBC) of ceftriaxone for B. burgdorferi N40 were determined to be 0.015 μg/ml (MIC) and 0.06 μg/ml (MBC), which are comparable to published MIC/MBC values of ceftriaxone for B. burgdorferi B31 (37, 55). Spirochetes (1 × 105 cells) were inoculated into 5-ml aliquots of liquid BSKII media prepared with serial 10-fold dilutions (100 μg/ml to 0.001 μg/ml) of ceftriaxone. The MIC was defined as the lowest concentration of ceftriaxone resulting in no visible growth of bacteria following incubation at 34°C for 3 days. Afterwards, 100 μl from each MIC culture was subcultured into 5 ml of BSKII media without antibiotics to determine the MBC, which was defined as the lowest corresponding concentration of ceftriaxone from the MIC cultures that demonstrated no visible growth following incubation at 34°C for 14 days. Tubes containing B. burgdorferi N40 without antibiotic and uninoculated media served as controls.
Ticks.
Ticks used in this study were members of a single population of larvae derived from a colony of laboratory-reared pathogen-free Ixodes scapularis ticks and were provided by Durland Fish of Yale University. Several days prior to necropsy, each of the mice was infested with approximately 40 larval ticks, which were allowed to feed to repletion. Engorged larvae were collected and allowed to molt into nymphs and harden, and then randomly selected members of tick cohorts from each mouse were tested for the presence of B. burgdorferi by PCR (xenodiagnosis). Nymphal ticks from these cohorts were used for transmission studies.
PCR analysis.
Spirochetal DNA was assessed by real-time quantitative PCR (Q-PCR), which was standardized and optimized for flagellin (flaB), outer surface protein A (ospA), and arthritis-related protein (arp), as described previously (23, 24). In addition, primers and an internal probe were developed for B. burgdorferi N40 vlsE. The B. burgdorferi N40 vlsE sequence has not been published, and primers based upon the B31 sequence failed to amplify vlsE from N40 DNA (data not shown). Therefore, an N40-specific sequence was obtained from an immunoreactive clone derived from screening an N40 genomic expression library with immune serum from infected mice, as described previously (14). The clone encoded a 318-bp fragment in which the first 100 bp shared 77% identity with B31 vlsE IR6 (vlsE 880-980) in addition to sequences that shared similarities of identity with 14 fragments within 18940-26270 on B31 linear plasmid 28-1 (lp28-1), where vlsE cassettes are located (11). From this clone, we designed a forward primer within the first 100-bp region (5′-TGATATGAAGAAGAAGGATAAGGTTGCT), a reverse primer that was downstream from this fragment (3′-TGTTGGTAAGAAGGAGGATGTACTAAAA), and an internal probe (GGATTGGCTAAAGATGGGAAGTTTTCGGTTACTAAT). The Q-PCR assay was optimized and all samples were assayed with positive and negative controls, as described previously (23, 24). DNA was extracted from tissues or ticks by use of DNeasy kits (Qiagen, Valencia, CA) according to the manufacturer's instructions for tissue or insects, respectively. Prior to DNA extraction, tissue samples were weighed, snap-frozen in liquid nitrogen, pulverized, and homogenized. Quantitative data were expressed as the number of DNA copies per milligram of tissue or the number of DNA copies per tick.
Serology.
Antibody titers against B. burgdorferi were assayed by enzyme linked immunosorbent assay (ELISA), as described previously (15). Ninety-six-well microtiter plates (Nunc ImmunoMax Maxi-Sorp, Wiesbaden, Germany) were coated with 1 μg/ml B. burgdorferi cN40 lysate in carbonate buffer (pH 9.6) and incubated overnight at 4°C. Coated plates were washed with phosphate-buffered saline-Tween 20 and blocked for 1 h with 1% bovine serum albumin, and then duplicate serial threefold dilutions of serum samples (starting at 1:100 dilution) were added to each well. Plates were again incubated overnight, washed, and then incubated for 2 h with alkaline phosphatase-conjugated rat anti-mouse immunoglobulin (heavy and light chain) diluted 1:5,000. Alkaline phosphatase substrate (Sigma, St. Louis, MO) (1 mg/ml) was then added to each well for color development. Optical density was measured at a test wavelength of 405 nm with an ELISA reader (Molecular Devices Corporation, Sunnyvale, CA). Each assay included positive and negative controls. Cutoff points for each dilution were established by testing absorbance of normal mouse serum samples, determining means, and adding 3 standard deviations above the means.
Histology and immunohistochemistry.
Formalin-fixed rear legs (demineralized in acid) and hearts were paraffin embedded and sectioned at 5 μm. Sections for histology were stained with hematoxylin and eosin. Legs were examined microscopically for evidence of arthritis and synovitis involving the knee and tibiotarsal joints as characterized by examination of infiltration of neutrophils, synovial proliferation, and exudation of fibrin into joint or tendon sheath lumina as well as neutrophil and macrophage infiltration of tissues at the base of the heart (carditis), as described in studies of C3H and C3H-scid mice (1, 4, 5, 8 ). Sections for immunohistochemical labeling of B. burgdorferi were processed using rabbit immune serum diluted 1:1,000 and biotinylated goat anti-rabbit immunoglobulin G (Vector Laboratories, Burlingame, CA), as described previously (7). Sections were randomly numbered and examined under blinded conditions without knowledge of treatment details.
Statistical analysis.
Statistical comparisons between treatment groups and time points were performed, using Student's t test or chi-square analysis. Multiple comparison analyses were performed with one-way analysis of variance followed by a least-difference post hoc test (StatView, PowerPC version; SAS Institute Inc., Cary, NC). Calculated P values lower than 0.05 were considered significant.
Experimental design.
The effectiveness of ceftriaxone or sham treatment was evaluated in mice following treatment that was commenced during the early (3 weeks) or late (4 months) stages of infection. These intervals were chosen to reflect two distinctly different phases of infection in the mouse model. The 3-week interval represented the early stage of infection during which the host immune response is evolving and disease (arthritis and carditis) is at its peak. The 4-month interval represented the persistent phase of infection, when host immunity is fully evolved and disease is resolved (5). Furthermore, spirochetes were sequestered in collagen during the late stage, making them potentially less vulnerable to antibiotic. Mice were subjected to necropsy at 1 and 3 months after completion of the 30-day treatment regimen at these two intervals. Infection status at necropsy was determined by culture and flaB DNA Q-PCR of tissues. In addition, infection status of mice was evaluated by xenodiagnosis, in which larval ticks were allowed to feed on mice several days prior to necropsy. Following feeding, molting, and hardening, nymphal ticks were tested for infection by flaB DNA Q-PCR. An attempt was made to obtain infectious spirochetes in ear tissues of mice by allograft transplantation of pieces of ear pinnae from antibiotic- or saline solution-treated mice into the subcutis of a single naïve C3H mouse. The recipient mice were subjected to necropsy, and tissues (urinary bladder, inoculation site, and quadriceps) were cultured and tested by flaB DNA Q-PCR (ear, inoculation site, heart base, ventricular muscle, tibiotarsus, and quadriceps tissue) at 3 weeks after allograft transplantation.
A confirmatory experiment was performed that examined antibiotic treatment during late infection. Mice were infected for 4 months, treated with antibiotic or saline solution, and then subjected to necropsy at 1 month after completion of treatment. In contrast to the initial study, additional tissue sites, including heart base, urinary bladder, ear, inoculation site, and tibiotarsus, were cultured. An attempt was made to increase the sensitivity of DNA detection using Q-PCR that targeted ospA DNA in lieu of flaB DNA, since ospA has been shown to be overrepresented relative to other targets (target imbalance) in tissue samples (42). PCR was performed using samples from additional tissue sites as well, including the inoculation site, subinoculation site (subcutis), heart base, ventricular muscle, tibiotarsus, quadriceps muscle, and ear. In addition, C3H-scid mice were utilized as recipients of allografts in lieu of C3H mice, and the recipient mice were assessed for infection at 3 weeks after transplant.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
RESULTS Antibiotic treatment during early infection.
When mice were treated with ceftriaxone at 3 weeks of infection and evaluated 1 month after the completion of treatment, none of the tissues from five mice were culture positive, but single tissues from two of five mice were flaB DNA Q-PCR positive (Table 1). One of the PCR-positive mice was also positive by xenodiagnosis, with one of nine ticks positive. None of the allografts transmitted infection to naïve mice, as determined based upon culture or PCR results. In contrast, multiple tissues from all sham-treated mice were culture positive and PCR positive, and all mice were positive by xenodiagnosis. Three of five mouse donors transferred infection by allograft. When mice treated during early infection were evaluated at 3 months after treatment, none of the tissues from three mice were positive by either culture or PCR. One of the three mice was positive by xenodiagnosis, but none of three donors transmitted infection by allograft. In contrast, all four sham-treated mice were positive by culture, PCR, xenodiagnosis, and allograft.
TABLE 1.
Culture, flaB DNA Q-PCR, xenodiagnosis, allograft, and immunohistochemistry results for individual mice treated with ceftriaxone or saline solution during early infection (3 weeks) and subjected to necropsy at 1 or 3 months after completion of treatment (more ...)
Antibiotic treatment during late infection.
When mice were treated with antibiotic at 4 months of infection and evaluated 1 month after completion of treatment, none of the tissues from eight mice were culture positive, but single tissues from all eight mice were flaB DNA Q-PCR positive; three of the eight mice were xenodiagnosis positive, but none transmitted infection by allograft (Table 2). In contrast, four of four sham-treated mice were positive by culture, PCR, xenodiagnosis, and allograft. When mice that were treated during late infection and then evaluated at 3 months after completion of treatment were examined, none of the tissues from five antibiotic-treated mice were culture positive, single tissue samples from two antibiotic-treated mice were PCR positive, two of the mice were positive by xenodiagnosis, and one mouse donor transmitted infection by allograft transplantation. In contrast, all four sham-treated mice were positive by culture, PCR, and xenodiagnosis, but none were positive by allograft. The prevalence of mice that remained positive by one or more indices (culture, PCR, xenodiagnosis) following antibiotic treatment during early versus late infection was significantly higher when mice were treated during late infection (chi-square test; P ≤ 0.05).
TABLE 2.
Culture, flaB DNA Q-PCR, xenodiagnosis, allograft, and immunohistochemistry results for individual mice treated with ceftriaxone or saline solution during late infection (4 months) and subjected to necropsy at 1 or 3 months after completion of treatment (more ...)
Quantitative DNA analysis.
The data in Table 1 and Table 2 summarize positive or negative flaB DNA Q-PCR results, but Q-PCR was also used to quantify spirochete flaB DNA copy numbers in tissues. Minimal numbers of or no flaB copies were detected in tissues of mice treated during early infection compared to the results seen with sham-treated mice. The two positive samples from antibiotic-treated mice contained only 2.5 and 2.7 flaB DNA copies/mg tissue, whereas positive tissues from saline solution-treated mice contained 40.8 ± 69.6 (mean ± standard deviation [SD]) flaB DNA copies/mg tissue. None of the antibiotic-treated mice were PCR positive at 3 months after treatment, but tissues from saline solution-treated mice contained 137.9 ± 176.3 (SD) flaB DNA copies/mg tissue. In contrast, low copy numbers of flaB DNA were detected in multiple tissues following treatment with antibiotic during late infection. Positive samples from mice at 1 month after treatment contained 33.7 ± 60.6 (SD) flaB DNA copies/mg tissue, in contrast to tissues from saline solution-treated mice, which contained a mean of 105.9 ± 285.6 (SD) flaB DNA copies/mg tissue. The two positive tissues from antibiotic-treated mice at 3 months after treatment contained 4.1 and 2.8 flaB DNA copies/mg, in contrast to tissues from saline solution-treated mice (mean, 266.8 ± 309.0 [SD] flaB DNA copies/mg tissue). All tissue samples that were flaB DNA-PCR positive were tested for arp and vlsE and were found to be positive for both arp and vlsE DNA by Q-PCR, thereby confirming the presence of lp28-1 essential genes (see Discussion). Likewise, selected flaB DNA-positive tick samples were also tested and found to be positive for arp and vlsE DNA (data not shown).
Immunohistochemical labeling of persisting spirochetes in tissues.
Immunohistochemistry confirmed the PCR findings and further demonstrated that intact antigen-positive organisms with spirochetal morphology, rather than merely DNA, were present in tissues (Table 1 and Table 2). Heart and tibiotarsal joint tissue sections were examined under blinded conditions for the presence of antigen-expressing spirochetes. Small numbers (one to four per site) of spirochetes could be visualized in collagenous tissues (Fig. (Fig.1)1) of one or more mice in all treatment groups, with the exception of the results seen with mice treated with antibiotic during early infection and examined at 1 month after treatment. Among the antibiotic-treated mice, single spirochetes were typically localized to collagenous tissue of the great vessels at the base of the heart and tendons or ligaments of the joints. Up to four spirochetes were visualized in heart and joint sections of saline solution-treated mice, and they were also occasionally found in the interstitium of the ventricular myocardium of saline solution-treated but not antibiotic-treated mice.
FIG. 1.
Immunohistochemical labeling of multiple B. burgdorferi spirochetes (arrows) in ligament tissue of the tibiotarsal joint of a saline solution-treated (control) mouse (A) and of a single spirochete (arrow) in ligament tissue of the tibiotarsal joint of (more ...)
Serum antibody response to B. burgdorferi following antibiotic treatment.
Serum antibody reactivity to B. burgdorferi was examined in mice following treatment with antibiotic or saline solution. In mice treated with antibiotic during early infection, antibody titers declined compared to saline solution-treated control results (P = 0.004; data not shown). In mice treated with antibiotic at 4 months of infection, antibody titers declined following completion of treatment and continued to decline progressively compared to saline solution-treated control results (Fig. (Fig.2).2). At 3 months following completion of treatment, antibody titers in antibiotic-treated mice were significantly lower than those in saline solution-treated mice (P = 0.0003). Results indicated that maintenance of the antibody response to B. burgdorferi requires active infection with a sufficient spirochete burden in tissues but that the antibody response declines following antibiotic treatment despite the presence of low numbers of spirochetes.
FIG. 2.
B. burgdorferi immunoglobulin G ELISA titers (mean reciprocal dilution ± SD) for mice treated with saline solution or ceftriaxone for 1 month, commencing at 4 months after infection. The dotted box (Rx) indicates the interval of treatment relative (more ...)
Confirmatory experiment with antibiotic treatment during late infection.
As in the previous experiment, tissues from 0 of 10 mice treated with ceftriaxone at 4 months of infection and then subjected to necropsy 1 month after treatment were positive by culture. However, tibiotarsal tissue samples from 9 of 10 mice were positive for ospA in DNA Q-PCR, as was heart base tissue from 8 of 10 mice, but that from other sites was PCR negative, with the exception of a single quadriceps muscle sample (Table 3). In contrast, all tissue sites in all four saline solution-treated mice were culture and PCR positive. The mean ospA DNA values for positive-testing heart base tissues of antibiotic-treated mice were 97 ± 118 (SD) copies/mg tissue compared to 3,495 ± 3,224 (SD) copies in saline solution-treated mice (P = 0.0018). A single tibiotarsal sample from an antibiotic-treated mouse contained 1,060 ospA DNA copies/mg tissue. Excluding that sample, the mean ospA DNA values for the remaining tibiotarsal tissues of antibiotic-treated mice were 24 ± 41 (SD) copies/mg tissue compared to 411 ± 107 (SD) copies in samples from saline solution-treated mice (P = 0.0039). Thus, antibiotic treatment resulted in negative culture results, but spirochetes appeared to survive in low numbers, as determined based on DNA levels.
TABLE 3.
Culture, ospA DNA Q-PCR, and xenodiagnosis results for individual mice treated with ceftriaxone or saline during late infection (4 months) and then examined 1 month after completion of treatment
Xenodiagnosis following antibiotic treatment during late infection.
Ticks were fed on the 10 mice treated with antibiotic and the four saline solution-treated mice in the confirmatory experiment (Table 3). Cohorts of eight nymphal ticks, derived from larvae that fed on each mouse, were evaluated by flaB DNA Q-PCR (except for one saline treated mouse, from which six ticks were tested). Six of 10 antibiotic-treated mice had one or two ticks that were PCR positive among the eight ticks tested. In contrast, all four saline solution-treated mice had three to five positive-testing ticks each. Q-PCR of positive-testing ticks from antibiotic-treated mice revealed a mean of 120.6 ± 75.1 (SD) (range, 28 to 222) flaB DNA copies per tick. In contrast, positive-testing ticks from saline solution-treated mice had a mean of 35,747 ± 40,705 (range, 19 to 151,000) flaB DNA copies per tick (P = 0.0005). An attempt was made to culture spirochetes from cohorts of ticks derived from antibiotic-treated mice that were xenodiagnosis (DNA) positive. Forty-two ticks, representing members of positive-testing cohorts, were cultured, but all were culture negative. In contrast, 5 of 12 ticks among a tick cohort from a single saline solution-treated, xenodiagnosis DNA-positive mouse were culture positive.
Tick-borne transmission of persisting spirochetes from antibiotic-treated mice to SCID mice.
In a further effort to isolate spirochetes from xenodiagnosis DNA-positive ticks from tick pools obtained from the confirmatory experiment, we infested C3H-scid mice with eight nymphal ticks from cohorts of ticks derived from xenodiagnosis DNA-positive C3H mice. Based upon results of culture of urinary bladder, inoculation site, and quadriceps muscle tissue at 3 weeks after feeding, 0 of 10 C3H-scid mice became infected following feeding by ticks from antibiotic-treated mice, in contrast to four of four mice that became infected following infestation with ticks derived from saline solution-treated mice.
In an effort to extend these findings, each of nine C3H-scid mice was infested with 15 to 20 nymphal ticks from xenodiagnosis DNA-positive cohorts of ticks derived from mice that were treated with antibiotics (Table 4). In order to verify that the SCID mice were actually exposed to DNA-positive ticks, the infection status of each of the ticks that were used to feed upon the SCID mice was determined by flaB Q-PCR after ticks fed to repletion, molted, and hardened. The infection status of the SCID mice was assessed by culture of urinary bladder, ear, and inoculation site tissue and by flaB DNA Q-PCR of ear, subinoculation site, heart base, and tibiotarsus tissue. Mice were subjected to necropsy at 3 weeks after tick feeding. With the exception of one ear sample, all sites were culture negative. The exception was a culture tube that contained a single nonmotile spirochete. In contrast, flaB Q-PCR results indicated that one or more tissue samples from eight of nine SCID mice were positive. Copy numbers were generally low, ranging from as few as 2.8 flaB DNA copies/mg tissue to as many as 50,500/mg tissue (excluding the 50,500/mg value, the mean was 656.2 flaB DNA copies/mg ± 1,175.1 [SD]). Thus, it appeared that C3H-scid mice supported somewhat higher populations of spirochetes than C3H mice, and yet we were unable to culture spirochetes from tissues. Finally, joints (knees and tibiotarsi) and hearts of the SCID mice were examined for histopathology. None of the SCID mouse tissues showed microscopic evidence of inflammation despite the high prevalence of B. burgdorferi ospA DNA in hearts and joints and the propensity of infected C3H-scid mice to develop progressive severe inflammation (8 ).
TABLE 4.
flaB DNA QT-PCR, PCR, and culture results for individual SCID mice at 3 weeks following feeding by ticks that fed upon mice treated with antibiotic during late infection (4 months)
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
DISCUSSION The present report extends and amends the findings of Bockenstedt et al. (9), who concluded that antibiotic treatment resulted in persistence of attenuated, noninfectious spirochetes that could be acquired by ticks (xenodiagnosis) but that infected ticks could not transmit infection to naïve hosts. The data in the present report differ from those conclusions in that antibiotic treatment resulted in persistence of low numbers of spirochetes in tissues of treated mice and that ticks could both acquire and transmit infectious spirochetes. Thus, results of the current study indicate that persisting spirochetes retain their infectivity, albeit at a low level. Quantitative PCR results indicate that very low copy numbers of spirochetal DNA were present in tissues from treated mice, as well as in ticks that acquired infection from treated mice. Normally, there is a burst of spirochetal replication in ticks following feeding, with a net increase in DNA copy numbers (24). This was not seen in ticks that fed on antibiotic-treated mice, in contrast to ticks that fed on saline solution-treated control mice. Notably, C3H-scid mice developed disseminated infections when fed on by ticks infected with spirochetes from antibiotic-treated mice, but spirochetes could not be cultured from the C3H-scid mice, and DNA copy numbers in tissues were generally low. These results support the notion that spirochetes were infectious but were altered in their ability to replicate even in globally immunodeficient hosts.
Because these conclusions are based upon DNA amplification, it could be argued that results do not absolutely prove the presence of live spirochetes. However, it has been shown that B. burgdorferi DNA does not persist in tissues unless live spirochetes are present (32, 42). We attempted to isolate spirochetes in order to characterize their plasmid content, but this was prevented by the inability of spirochetes to replicate in culture, despite the sensitivity of our culture method for detecting low numbers of spirochetes. This result was reinforced by the finding of a culture from an antibiotic-treated tick-infected C3H-scid mouse that contained a single nonmotile spirochete. In addition, the low levels of spirochetal DNA precluded detection of RNA transcription despite attempts to amplify cDNA (data not shown). We therefore undertook an exhaustive search for morphologically intact, antigen-expressing spirochetes in tissues by immunohistochemistry. There is increasing evidence that collagen is a critical niche for spirochete survival and possibly immune evasion (7, 30). We have found that vessels at the base of the heart and in ligaments and tendons of the tibiotarsal region (as well as in other joint tissues) are collagen-rich preferential regions for spirochetes in the persistent phase of infection (7). When these sites were examined by immunohistochemistry in the present study, low numbers of spirochetes were visualized in collagenous tissues of both antibiotic- and saline solution-treated mice. In C3H-scid mice infected with ticks from antibiotic-treated mice, the heart base and tibiotarsus tissues were also consistently positive by PCR. These findings support the idea of the viability of spirochetes following antibiotic treatment and further incriminate collagen as a preferential site of persistence that may contribute to antibiotic treatment failure. A study in which mice were treated with ceftriaxone for only 5 days resulted in similar findings, with detection of persisting spirochetal DNA in joint tissue (70). Persistence of Borrelia burgdorferi following antibiotic treatment of human patients in studies investigating collagenous tissue, including ligamentous tissue (21), synovium tissue (47), and skin tissue (25, 45), has also been documented.
The study by Bockenstedt et al. (9) utilized standard PCR to determine whether critical infectivity-associated plasmids or genes were present to explain the attenuation of spirochetes. The presence of lp25 of B. burgdorferi B31 has been shown to be essential for infectivity (49). The essential component has been defined as a single gene on lp25 that encodes a nicotinamidase (48 ). In addition, it appears that determinants encoded on lp28-1 of B. burgdorferi B31 affect relative infectivity (27, 28, 49). The lp28-1 plasmid of B. burgdorferi B31 encodes two functional genes, vlsE and arp (p37-47) in addition to a number of paralogous genes that are encoded on other plasmids or chromosomes, pseudogenes, genes with frame shift mutations, or sequences that encode products that are consist of fewer than 100 amino acids (16). Bockenstedt et al. (9) used standard PCR to evaluate the presence of BBE21.1, which is specific for lp25, and arp (p37-47), which is specific for lp28-1, and were unable to consistently amplify these targets in infected ticks that fed on antibiotic-treated mice. We tested DNA from three flaB DNA-positive ticks that fed on antibiotic-treated mice for the lp25 target and confirmed its presence. Since lp25 appears to be absolutely essential for infectivity and since our studies demonstrated the presence of infectivity, we focused on lp28-1 targets vlsE and arp. When B. burgdorferi N40-specific primers were used, both targets were present in all flaB DNA-positive samples tested by Q-PCR. It should be noted that the B. burgdorferi N40 genome is configured differently from the B. burgdorferi B31 genome and that vlsE and arp appear to be located on separate plasmids in B. burgdorferi N40 (S. Casjens, unpublished observations). Thus, using Q-PCR, which is more sensitive than standard PCR, we found no evidence of missing vlsE or arp. Loss of other plasmids has also been associated with diminished infectivity (33, 53, 68 ). Although we did not survey the entire genome, we found no evidence of spirochetes missing the critical infectivity-related genes that are homologous to B. burgdorferi B31 lp25 and lp28-1 in tissue samples from either mice or ticks.
There are a number of possible variables that may have influenced persistence of spirochetes in tissues following ceftriaxone treatment in this study. B. burgdorferi N40 has been shown to differ from other B. burgdorferi strains by being resistant to erythromycin compared to B. burgdorferi strains B31 and 297 (64), but B. burgdorferi N40 is as susceptible as B. burgdorferi B31 to ceftriaxone, as determined based upon MIC/MBC analysis in this study and by others (37, 55). Furthermore, serum levels of ceftriaxone in treated mice were well above the MIC/MBC. Nevertheless, the pharmacokinetics of ceftriaxone in mice differ from that of humans, as the trough levels in serum of treated humans are approximately 15 μg/ml at 24 h (43), whereas they were undetectable in mice at 8 h. Thus, the treatment regimen used for the mice, albeit long term, created a pulsed-dose effect. Studies with Enterococcus faecalis have shown that pulsed doses of penicillin resulted in development of bacterial tolerance to antibiotic without changes in resistance, whereas continuous treatment did not (22). Ceftriaxone binds to carboxypeptidases, endopeptidases, and transpeptidases in the cytoplasmic membrane and thereby inhibits cell wall synthesis and cell division (26). Spirochetes within collagen, especially in the persistent phase of infection, may be in a metabolically dormant (nondividing) state, with minimal cell wall synthesis, and this may affect levels of tolerance of ceftriaxone. Similar ?persister cells? have been documented in a variety of bacterial infections (29, 54). Our findings parallel those of Straubinger et al. (59, 61, 62), who noted that cultures were uniformly negative in PCR-positive tissues from antibiotic-treated dogs in spite of the fact that culture assays were typically more sensitive than PCR for detection of B. burgdorferi in tissues of untreated dogs. These results fit with the concept of persister cells that evade killing by antibiotics. Further studies are needed to determine whether persisting B. burgdorferi spirochetes can revert to a dividing, pathogenic state.
The current study indicated that accessible indices of treatment, such as culture or PCR of skin and serologic response, cannot be relied upon as markers for treatment success. A declining antibody response, as has been noted following antibiotic treatment in mice (9) as well as in antibiotic-treated dogs (61), occurs despite low levels of persisting spirochetes. Our results show that spirochetes are viable and transmissible and express antigen (based upon immunohistochemistry results) following antibiotic treatment, particularly when commenced during the late stage of infection. However, the few residual spirochetes appeared to be altered in their ability to replicate, and this may explain the lack of inflammation that we noted in SCID mouse tissues. Although overt disease may not be present, the continued expression of lipoproteins by B. burgdorferi may contribute to persistence of constitutional symptoms. Spirochetal lipoproteins have been shown to potently elicit a wide variety of proinflammatory responses (12, 13, 18, 19, 31, 36, 39, 40, 50, 57, 63, 65, 66, 69). This may explain the slow recovery period (termed ?post-Lyme disease syndrome?) that has been noted following antibiotic treatment of patients (67). Further studies are needed to determine the eventual fate of the persisting organisms following antibiotic treatment in the context of controlled animal studies.
AcknowledgmentsThis work was supported by Public Health Service grant AI-26815 from the National Institute of Allergy and Infectious Diseases.
The authors are indebted to Gary Wormser for editorial comments and to Durland Fish for provision of ticks used in this study.
FootnotesPublished ahead of print on 3 March 2008.
Top
Abstract
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
REFERENCES1. Armstrong, A. L., S. W. Barthold, D. H. Persing, and D. S. Beck. 1992. Carditis in Lyme disease susceptible and resistant strains of laboratory mice infected with Borrelia burgdorferi. Am. J. Trop. Med. Hyg. 47:249-258. [PubMed]
2. Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57:521-525. [PubMed]
3. Barthold, S. W. 1993. Antigenic stability of Borrelia burgdorferi during chronic infections of immunocompetent mice. Infect. Immun. 61:4955-4961. [PubMed]
4. Barthold, S. W. 1996. Lyme borreliosis in the laboratory mouse. J. Tick-Borne Spirochetal Dis. 3:22-44.
5. Barthold, S. W., M. S. de Souza, J. L. Janotka, A. L. Smith, and D. H. Persing. 1993. Chronic Lyme borreliosis in the laboratory mouse. Am. J. Pathol. 143:951-971.
6. Barthold, S. W., E. Fikrig, L. K. Bockenstedt, and D. H. Persing. 1995. Circumvention of outer surface protein A immunity by host-adapted Borrelia burgdorferi. Infect. Immun. 63:2255-2261. [PubMed]
7. Barthold, S. W., E. Hodzic, S. Tunev, and S. Feng. 2006. Antibody-mediated disease remission in the mouse model of Lyme borreliosis. Infect. Immun. 74:4817-4825. [PubMed]
8. Barthold, S. W., C. L. Sidman, and A. L. Smith. 1992. Lyme borreliosis in genetically resistant and susceptible mice with severe combined immunodeficiency. Am. J. Trop. Med. Hyg. 47:605-613. [PubMed]
9. Bockenstedt, L. K., J. Mao, E. Hodzic, S. W. Barthold, and D. Fish. 2002. Detection of attenuated, non-infectious spirochetes after antibiotic treatment of Borrelia burgdorferi-infected mice. J. Infect. Dis. 186:1430-1437. [PubMed]
10. Bradley, J. F., R. C. Johnson, and J. L. Goodman. 1994. The persistence of spirochetal nucleic acids in active Lyme arthritis. Ann. Int. Med. 120:487-489. [PubMed]
11. Casjens, S., N. Palmer, R. vanVugt, W. M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, and C. M. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490-516. [PubMed]
12. de Souza, M. S., E. Fikrig, A. L. Smith, R. A. Flavell, and S. W. Barthold. 1992. Nonspecific proliferative responses of murine lymphocytes to Borrelia burgdorferi antigens. J. Infect. Dis. 165:471-478. [PubMed]
13. Ebnet, K., K. D. Brown, U. K. Siebenlist, M. M. Simon, and S. Shaw. 1997. Borrelia burgdorferi activates nuclear factor-KB and is a potent inducer of chemokine and adhesion molecule gene expression in endothelial cells and fibroblasts. J. Immunol. 158:3285-3292. [PubMed]
14. Feng, S., E. Hodzic, and S. W. Barthold. 2000. Lyme arthritis resolution with antiserum to a 37-kilodalton Borrelia burgdorferi protein. Infect. Immun. 68:4169-4173. [PubMed]
15. Feng, S., E. Hodzic, B. Stevenson, and S. W. Barthold. 1998. Humoral immunity to Borrelia burgdorferi N40 decorin binding proteins during infection of laboratory mice. Infect. Immun. 66:2827-2835. [PubMed]
16. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J. F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. vanVugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586. [PubMed]
17. Fraser, D. D., L. I. King, and F. W. Miller. 1992. Molecular detection of persistent Borrelia burgdorferi in a man with dermatomyositis. Clin. Exp. Rheumatol. 10:387-390. [PubMed]
18. Giambartolomei, G. H., V. A. Dennis, B. L. Lasater, and M. T. Philipp. 1999. Induction of pro- and anti-inflammatory cytokines by Borrelia burgdorferi lipoproteins in monocytes is mediated by CD14. Infect. Immun. 67:140-147. [PubMed]
19. Giambartolomei, G. H., V. A. Dennis, and M. T. Philipp. 1998. Borrelia burgdorferi stimulates the production of interleukin-10 in peripheral blood mononuclear cells from uninfected humans and rhesus monkeys. Infect. Immun. 66:2691-2697. [PubMed]
20. Goodman, J. L., P. Jurkovich, C. Kodner, and R. C. Johnson. 1991. Persistent cardiac and urinary tract infections with Borrelia burgdorferi in experimentally infected Syrian hamsters. J. Clin. Microbiol. 29:894-896. [PubMed]
21. Häupl, T., G. Hahn, M. Rittig, A. Krause, C. Schoerner, U. Schonherr, J. R. Kalden, and G. R. Burmester. 1993. Persistence of Borrelia burgdorferi in ligamentous tissue from a patient with chronic Lyme borreliosis. Arthritis Rheum. 36:1621-1626. [PubMed]
22. Hodgess, T. L., S. Zighelboim-Daum, G. M. Eliopoulos, C. Wennersten, and R. C. Moellering, Jr. 1992. Antimicrobial susceptibility changes in Enterococcus faecalis following various penicillin exposure regimens. Antimicrob. Agents Chemother. 36:121-125. [PubMed]
23. Hodzic, E., S. Feng, K. Freet, and S. W. Barthold. 2003. Borrelia burgdorferi population dynamics and prototype gene expression during infection of immunocompetent and immunodeficient mice. Infect. Immun. 71:5042-5055. [PubMed]
24. Hodzic, E., S. Feng, K. J. Freet, D. L. Borjesson, and S. W. Barthold. 2002. Borrelia burgdorferi population kinetics and selected gene expression at the host-vector interface. Infect. Immun. 70:3382-3388. [PubMed]
25. Hudson, B. J., M. Stewart, V. A. Lennox, M. Fukunaga, M. Yabuki, H. Macorison, and J. Kitchener-Smith. 1998. Culture-positive Lyme borreliosis. Med. J. Aust. 168:500-502. [PubMed]
26. Klein, N. C., and B. A. Cunha. 1995. Third-generation cephalosporins. Med. Clin. N. Am. 79:705-719. [PubMed]
27. Labandeira-Rey, M., J. Seshu, and J. Skare. 2003. The absence of linear plasmid 25 or 28-1 of Borrelia burgdorferi dramatically alters the kinetics of experimental infection via distinct mechanisms. Infect. Immun. 71:4608-4613. [PubMed]
28. Labandeira-Rey, M., and J. T. Skare. 2001. Decreased infectivity in Borrelia burgdorferi strain B31 is associated with loss of linear plasmid 25 or 28-1. Infect. Immun. 69:446-455. [PubMed]
29. Lewis, K. 2007. Persister cells, dormancy and infectious disease. Nat. Rev. Microbiol. 5:48-56. [PubMed]
30. Liang, F. T., E. L. Brown, T. Wang, R. V. Iozzo, and E. Fikrig. 2004. Protective niche for Borrelia burgdorferi to evade humoral immunity. Amer. J. Pathol. 165:977-985. [PubMed]
31. Ma, Y., K. P. Seiler, K.-F. Tai, L. Yang, M. Woods, and J. J. Weis. 1994. Outer surface lipoproteins of Borrelia burgdorferi stimulate nitric oxide production by the cytokine-inducible pathway. Infect. Immun. 62:3663-3671. [PubMed]
32. Malawista, S. M., S. W. Barthold, and D. H. Persing. 1994. Fate of Borrelia burgdorferi DNA in tissues of infected mice after antibiotic treatment. J. Infect. Dis. 170:1312-1316. [PubMed]
33. McDowell, J. V., S. Y. Sung, M. Labandeira-Rey, J. T. Skare, and R. T. Marconi. 2001. Analysis of mechanisms associated with loss of infectivity of clonal populations of Borrelia burgdorferi B31MI. Infect. Immun. 69:3670-3677. [PubMed]
34. Moody, K. D., R. L. Adams, and S. W. Barthold. 1994. Effectiveness of antimicrobial treatment against Borrelia burgdorferi infection in mice. Antimicrob. Agents Chemother. 38:1567-1572. [PubMed]
35. Moody, K. D., S. W. Barthold, G. A. Terwilliger, D. S. Beck, G. M. Hansen, and R. O. Jacoby. 1990. Experimental chronic Lyme borreliosis in Lewis rats. Am. J. Trop. Med. Hyg. 42:165-174. [PubMed]
36. Morrison, T. B., J. H. Weis, and J. J. Weis. 1997. Borrelia burgdorferi outer surface protein A (OspA) activates and primes human neutrophils. J. Immunol. 158:4838-4845. [PubMed]
37. Murgia, R., F. Marchetti, and M. Cinco. 1999. Comparative bacteriostatic and bacteriocidal activities of cefodinzine against Borrelia burgdorferi sensu lato. Antimicrob. Agents Chemother. 43:3030-3032. [PubMed]
38. Nocton, J. J., F. Dressler, R. J. Rutledge, P. N. Rys, D. H. Persing, and A. C. Steere. 1994. Detection of Borrelia burgdorferi DNA by polymerase chain reaction in synovial fluid from patients with Lyme arthritis. N. Engl. J. Med. 330:229-234. [PubMed]
39. Norgard, M., B. Riley, J. Richardson, and J. Radolf. 1995. Dermal inflammation elicited by synthetic analogs of Treponema pallidum and Borrelia burgdorferi lipoproteins. Infect. Immun. 63:1507-1515. [PubMed]
40. Norgard, M. V., L. L. Arndt, D. R. Akins, L. L. Curetty, D. A. Harrich, and J. D. Radolf. 1996. Activation of human monocytic cells by Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides proceeds via a pathway distinct from that of lipopolysaccharide but involves the transcriptional activator NF-κB. Infect. Immun. 64:3845-3852. [PubMed]
41. Oksi, J., M. Marjamaki, J. Nikoskelainen, and M. K. Viljanen. 1999. Borrelia burgdorferi detected by culture and PCR in clinical relapse of disseminated Lyme borreliosis. Ann. Med. 31:225-232. [PubMed]
42. Persing, D. H., B. J. Rutledge, P. N. Rys, D. S. Podzorski, P. D. Mitchell, K. D. Reed, B. Liu, E. Fikrig, and S. E. Malawista. 1994. Target imbalance: disparity of Borrelia burgdorferi genetic material in synovial fluid from Lyme arthritis patients. J. Infect. Dis. 169:668-672. [PubMed]
43. Pollock, A. A., P. E. Tee, I. H. Patel, J. Spicehandler, M. S. Simberkoff, and J. J. Rahal, Jr. 1982. Pharmacokinetic characteristics of intravenous ceftriaxone in normal adults. Antimicrob. Agents Chemother. 22:816-823. [PubMed]
44. Preac Mursic, V., E. Patsouris, B. Wilske, S. Reinhardt, B. Gos, and P. Mehraein. 1990. Persistence of Borrelia burgdorferi and histopathological alterations in experimentally infected animals; comparison with histopathological findings in human Lyme disease. Infection 18:332-341. [PubMed]
45. Preac Mursic, V., H. W. Pfister, B. Wilske, B. Gross, A. Baumann, and J. Prokop. 1989. Survival of Borrelia burgdorferi in antibiotically treated patients with Lyme borreliosis. Infection 17:355-359. [PubMed]
46. Preac Mursic, V., B. Wilske, G. Schierz, H. W. Pfister, and K. Einhaupl. 1984. Repeated isolation of spirochetes from the cerebrospinal fluid of a patient with meningoradiculitis Bannwarth. Eur. J. Clin. Microbiol. 3:564-565. [PubMed]
47. Priem, S., G. R. Burmester, T. Kamradt, K. Wolbart, M. G. Rittig, and A. Krause. 1998. Detection of Borrelia burgdorferi by polymerase chain reaction in synovial membrane, but not in synovial fluid from patients with persisting Lyme arthritis after antibiotic therapy. Ann. Rheum Dis. 57:118-121. [PubMed]
48. Purser, J. E., M. B. Lawrenz, M. J. Caimano, J. K. Howell, J. D. Radolf, and S. J. Norris. 2003. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host. Mol. Microbiol. 48:753-764. [PubMed]
49. Purser, J. E., and S. J. Norris. 2000. Correlation between plasmid content and infectivity of Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:13865-13870. [PubMed]
50. Radolf, J. D., L. L. Arndt, D. R. Akins, L. L. Curetty, M. E. Levi, Y. N. Shen, L. S. Davis, and M. V. Norgard. 1995. Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides activate monocytes/macrophages. J. Immunol. 154:2866-2877. [PubMed]
51. Roberts, E. D., R. F. Bohm, F. B. Cogswell, H. N. Lanners, R. C. Lowrie, L. Povinelli, J. Piesman, and M. T. Philipp. 1995. Chronic Lyme disease in the rhesus monkey. Lab. Investig. 72:146-160. [PubMed]
52. Schmidli, J., T. Hunziker, P. Moesli, and U. B. Schaad. 1988. Cultivation of Borrelia burgdorferi from joint fluid three months after treatment of facial palsy due to Lyme borreliosis. J. Infect. Dis. 158:905-906. [PubMed]
53. Schwan, T. G., W. Burgdorfer, and C. F. Garon. 1988. Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation. Infect. Immun. 56:1831-1836. [PubMed]
54. Shah, D., Z. Zhang, A. Khodursky, N. Kaldalu, K. Kurg, and K. Lewis. 2006. Persisters: a distinct physiologic state of E. coli. BMC Microbiol. 6:53-61. [PubMed]
55. Sicklinger, M., R. Wienecke, and U. Neubert. 2003. In vitro susceptibility testing of four antibiotics against Borrelia burgdorferi: a comparison of results for the three genospecies Borrelia afzelii, Borrelia garinii, and Borrelia burgdorferi sensu stricto. J. Clin. Microbiol. 41:1791-1793. [PubMed]
56. Snydman, D. R., D. P. Schenkein, V. P. Berardi, C. C. Lastavica, and K. M. Pariser. 1986. Borrelia burgdorferi in joint fluid in chronic Lyme arthritis. Ann. Int. Med. 104:798-800. [PubMed]
57. Sobek, V., N. Birkner, I. Falk, A. Wurch, C. J. Kirschning, H. Wagner, R. Wallich, M. C. Lamers, and M. M. Simon. 2004. Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease. Arthritis Res. Ther. 6:R433-R446. [PubMed]
58. Stanek, G., J. Klein, R. Bittner, and D. Glogar. 1990. Isolation of Borrelia burgdorferi from the myocardium of a patient with longstanding cardiomyopathy. N. Engl. J. Med. 322:249-252. [PubMed]
59. Straubinger, R. K. 2000. PCR-based quantification of Borrelia burgdorferi organisms in canine tissue over a 500-day postinfection period. J. Clin. Microbiol. 38:2191-2199. [PubMed]
60. Straubinger, R. K., A. F. Straubinger, B. A. Summers, H. N. Erb, L. Harter, and M. J. G. Appel. 1998. Borrelia burgdorferi induces the production and release of proinflammatory cytokines in canine synovial explant cultures. Infect. Immun. 66:247-258. [PubMed]
61. Straubinger, R. K., A. F. Straubinger, B. A. Summers, and R. H. Jacobson. 2000. Status of Borrelia burgdorferi infection after antibiotic treatment and the effects of corticosteroids: an experimental study. J. Infect. Dis. 181:1069-1081. [PubMed]
62. Straubinger, R. K., B. A. Summers, Y. F. Chang, and M. J. G. Appel. 1997. Persistence of Borrelia burgdorferi in experimentally infected dogs after antibiotic treatment. J. Clin. Microbiol. 35:111-116. [PubMed]
63. Tai, K. F., Y. Ma, and J. J. Weis. 1994. Normal human B lymphocytes and mononuclear cells respond to the mitogenic and cytokine-stimulatory activities of Borrelia burgdorferi and its lipoprotein OspA. Infect. Immun. 62:520-528. [PubMed]
64. Terekhova, D., M. L. Sartakova, G. P. Wormser, I. Schwartz, and F. C. Cabello. 2002. Erythromycin resistance in Borrelia burgdorferi. Antimicrob. Agents Chemother. 46:3637-3640. [PubMed]
65. Weis, J. J., Y. Ma, and L. F. Erdile. 1994. Biological activities of native and recombinant Borrelia burgdorferi outer surface protein A: dependence on lipid modification. Infect. Immun. 62:4632-4636. [PubMed]
66. Wooten, R. M., V. R. Modur, T. M. McIntyre, and J. J. Weis. 1996. Borrelia burgdorferi outer membrane protein A induces nuclear translocation of nuclear factor-kappa B and inflammatory activation in human endothelial cells. J. Immunol. 157:4584-4590. [PubMed]
67. Wormser, G. P., R. J. Dattwyler, E. D. Shapiro, J. J. Halperin, A. C. Steere, M. S. Klempner, P. J. Krause, J. S. Bakken, F. Strle, G. Stanek, L. Bockenstedt, D. Fish, J. S. Dumler, and R. B. Nadelman. 2006. The clinical assessment, treatment, and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: clinical practice guidelines by the Infectious Diseases Society of America. Clin. Infect. Dis. 43:1089-1134. [PubMed]
68. Xu, Y. N., C. Kodner, L. Coleman, and R. C. Johnson. 1996. Correlation of plasmids with infectivity of Borrelia burgdorferi sensu stricto type strain B31. Infect. Immun. 64:3870-3876. [PubMed]
69. Yang, L. M., Y. Ma, R. Schoenfeld, M. Griffiths, E. Eichwald, B. Aranco, and J. J. Weis. 1992. Evidence for lymphocyte-B mitogen activity in Borrelia burgdorferi-infected mice. Infect. Immun. 60:3033-3041. [PubMed]
70. Yrjänäinen, H., J. Hyotenen, S. R. Song, J. Oksi, K. Hartiala, and M. K. Viljanen. 2007. Anti-tumor necrosis factor-alpha treatment activates Borrelia burgdorferi spirochetes in 4 weeks after ceftriaxone treatment in C3H/He mice. J. Infect. Dis. 195:1489-1496. [PubMed]
-
Sailairina
- Viestit:565
- Liittynyt:Ma Tammi 19, 2009 16:04
- Paikkakunta:Kaarina
Borreliabakteerin selviytyminen: biofilmi
MacDonald kertoi mm. UOS-elokuvassa löytäneensä borreliabakteerin ns. biofilmin suojasta ja siten toteaa potilaiden olleen koko ajan oikeassa taudista parantumattomuuden suhteen.
Hänen biofilmi- ja muita tärkeitä artikkeleita voi lukea sivuilta:
http://www.molecularalzheimer.org/
Alitalo sivuaa biofilmiä väitöskirjassaan vuonna 2004:
? We observed a form of biofilm-formation of large Borrelia burgdorferi bundles (see cover; unpublished), which likely served to protect Borrelia bacteria from complement. This may be analogous to attack of the complement system on tumors, where the outer cell-layers are attacked, but the inner layers protected (128). This mechanism has also been documented elsewhere (76). MMPs (68, 75, 129) enable the spirochetes to invade tissues and when they are able to grow into a larger population, they may be able to shield each other by forming a form of biofilm. Because there was a very large amount of bacteria, the majority of the cells were not attacked.?
Yleisellä tasolla (biofilmien suhteen) suomeksi on olemassa ainakin yksi oikein valaiseva kirjoitus (linkki on ollut joskus aikaisemminkin foorumilla): http://www.mm.helsinki.fi/users/lindstr ... ilmit.html
Katkelmia siitä:
"Nykyisin useimmat akuutit infektiot voidaan tehokkaasti hoitaa antibiooteilla. On kuitenkin kaksi tärkeää poikkeusta; ensimmäinen on antibioottiresistentit bakteerit ja toinen on biofilmien bakteerit"
"Biofilmien suojassa elävät bakteerit voivat olla jopa tuhat kertaa vastustuskykyisempiä antibioottihoidoille kuin samat vapaina kasvavat bakteerit"
"Biofilmi suojaa mikrobeja mm. valolta, kuivumiselta, äärilämpötiloilta ja pesu- ja antimikrobisilta aineilta"
"Biofilmit voivat muodostua yhdestä tai useasta bakteerilajista. Bakteerien lisäksi biofilmeissä esiintyy sieniä, leviä, hiivoja ja alkueläimiä sekä erilaisia orgaanisia ja epäorgaanisia yhdisteitä "
"Biofilmin muodostuminen on monimutkainen prosessi, joka vaatii bakteereilta kollektiivista käyttäytymistä, vuorovaikutuksia ja kommunikointia eri mikrobisolujen välillä"
"Toisaalta biofilmin bakteerisolut vapauttavat myös antigeenejä ja stimuloivat siten vasta-aineiden tuottoa. Tässäkään tapauksessa puolustusmekanismin toiminta ei ole täydellistä. Elimistön vapauttamat vasta-aineet pystyvät tappamaan ainoastaan yksittäisiä bakteereja. Ne eivät ole tehokkaita biofilmin bakteereja vastaan. Näin ollen edes hyvän humoraalisen ja sellulaarisen immuunisysteemin omistavilla ihmisillä harvoin pelkkä luonnollinen puolustusjärjestelmä yksinään pystyy selvittämään biofilmi-infektion"
"Antibioottihoitokin vaikuttaa vain vapaisiin ja biofilmistä vapautuviin bakteereihin. Se ei yleensä tapa itse biofilmiä. Tästä syystä biofilmi-infektioihin kuuluvat uusiutuvat oireet useidenkin antibioottihoitojen jälkeen "
MacDonald kertoi mm. UOS-elokuvassa löytäneensä borreliabakteerin ns. biofilmin suojasta ja siten toteaa potilaiden olleen koko ajan oikeassa taudista parantumattomuuden suhteen.
Hänen biofilmi- ja muita tärkeitä artikkeleita voi lukea sivuilta:
http://www.molecularalzheimer.org/
Alitalo sivuaa biofilmiä väitöskirjassaan vuonna 2004:
? We observed a form of biofilm-formation of large Borrelia burgdorferi bundles (see cover; unpublished), which likely served to protect Borrelia bacteria from complement. This may be analogous to attack of the complement system on tumors, where the outer cell-layers are attacked, but the inner layers protected (128). This mechanism has also been documented elsewhere (76). MMPs (68, 75, 129) enable the spirochetes to invade tissues and when they are able to grow into a larger population, they may be able to shield each other by forming a form of biofilm. Because there was a very large amount of bacteria, the majority of the cells were not attacked.?
Yleisellä tasolla (biofilmien suhteen) suomeksi on olemassa ainakin yksi oikein valaiseva kirjoitus (linkki on ollut joskus aikaisemminkin foorumilla): http://www.mm.helsinki.fi/users/lindstr ... ilmit.html
Katkelmia siitä:
"Nykyisin useimmat akuutit infektiot voidaan tehokkaasti hoitaa antibiooteilla. On kuitenkin kaksi tärkeää poikkeusta; ensimmäinen on antibioottiresistentit bakteerit ja toinen on biofilmien bakteerit"
"Biofilmien suojassa elävät bakteerit voivat olla jopa tuhat kertaa vastustuskykyisempiä antibioottihoidoille kuin samat vapaina kasvavat bakteerit"
"Biofilmi suojaa mikrobeja mm. valolta, kuivumiselta, äärilämpötiloilta ja pesu- ja antimikrobisilta aineilta"
"Biofilmit voivat muodostua yhdestä tai useasta bakteerilajista. Bakteerien lisäksi biofilmeissä esiintyy sieniä, leviä, hiivoja ja alkueläimiä sekä erilaisia orgaanisia ja epäorgaanisia yhdisteitä "
"Biofilmin muodostuminen on monimutkainen prosessi, joka vaatii bakteereilta kollektiivista käyttäytymistä, vuorovaikutuksia ja kommunikointia eri mikrobisolujen välillä"
"Toisaalta biofilmin bakteerisolut vapauttavat myös antigeenejä ja stimuloivat siten vasta-aineiden tuottoa. Tässäkään tapauksessa puolustusmekanismin toiminta ei ole täydellistä. Elimistön vapauttamat vasta-aineet pystyvät tappamaan ainoastaan yksittäisiä bakteereja. Ne eivät ole tehokkaita biofilmin bakteereja vastaan. Näin ollen edes hyvän humoraalisen ja sellulaarisen immuunisysteemin omistavilla ihmisillä harvoin pelkkä luonnollinen puolustusjärjestelmä yksinään pystyy selvittämään biofilmi-infektion"
"Antibioottihoitokin vaikuttaa vain vapaisiin ja biofilmistä vapautuviin bakteereihin. Se ei yleensä tapa itse biofilmiä. Tästä syystä biofilmi-infektioihin kuuluvat uusiutuvat oireet useidenkin antibioottihoitojen jälkeen "
-
Sailairina
- Viestit:565
- Liittynyt:Ma Tammi 19, 2009 16:04
- Paikkakunta:Kaarina
Mikroskooppi-/videokuvaa biofilmistä:
http://www.youtube.com/watch?v=BMxOBgxIVsQ
Biofilm of borrelia burgdorferi B31 strain
http://www.youtube.com/watch?v=BMxOBgxIVsQ
Biofilm of borrelia burgdorferi B31 strain
-
Sailairina
- Viestit:565
- Liittynyt:Ma Tammi 19, 2009 16:04
- Paikkakunta:Kaarina
http://www.duodecimlehti.fi/web/guest/e ... ku_p_auth=
"Lymen borrelioosi
Duodecim
1992;108(9):846
Matti K. Viljanen, Pekka T. Lehtinen
Lymen borrelioosi on Suomessakin merkittävä kansanterveysongelma. Borrelioosin leviämistapojen ja oireiden hyvä tuntemus on taudin ehkäisyn ja hoidon perusta. Varhaisborrelioosin diagnosointi perustuu anamneesiin ja kliinisiin oireisiin; myöhäisborrelioosin diagnostiikassa serologian tehokkuus on tärkeää. Erityistapauksissa voidaan käyttää viljelyä ja uusia DNA-tekniikoita. Varhaisborrelioosi voidaan hoitaa avohoidossa. Sen tyyppioire, erythema migrans (EM), edellyttää aina mikrobilääkehoitoa. Myöhäisborrelioosi voi vaatia pitkiäkin hoitokuureja, jotka on käynnistettävä keskussairaalatasoisessa hoitopaikassa. Borrelioosin patogeneesissa on vielä paljon tuntemattomia seikkoja. Potilaan geneettiset tekijät todennäköisesti vaikuttavat siihen, minkälaisen taudin borrelia hänessä aiheuttaa. "
"Borrelia burgdorferi
Borreliat kuuluvat yhdessä treponeemojen ja leptospirojen kanssa spirokeettojen heimoon. Borreliat ovat muita spirokeettoja pidempiä ja kierteisyydeltään epämääräisempiä. B. burgdorferi on pisin (20-30 mm) ja ohuin (0.2-0.3 mm) borrelia. Bakteeri voi joskus kasvaa kierteettömänä rihmana ja muodostaa monimutkaisia vyyhtejä (kuva 14) (Aberer ym. 1991).
Borrelioiden ulkokalvo on perusrakenteeltaan gramnegatiivisten bakteerien ulkokalvon kaltainen. Se on kuitenkin hyvin liikkuva ja voi siirtyä bakteerisolun toiseen päähän bakteerin elintoimintojen siitä kärsimättä. Tämä "cappingiksi" kutsuttu ilmiö ilmeisesti auttaa borreliaa kiinnittymään kohdesoluihinsa (Barbour ja Hayes 1986). Ulkokalvosta irtoaa myös runsain määrin vaihtelevan kokoisia pallosia eli "blebsejä".
Borrelioiden flagellat sijaitsevat monista muista bakteereista poiketen solukalvon ja ulkokalvon välissä. Ne liikuttavat bakteeria aiheuttamalla porautuvan liikkeen. "
"Borrelia kasvaa puutiaisen ohutsuolessa ja kulkeutuu sieltä sylkirauhaseen (Barbour ja Hayes 1986). Spirokeetat siirtyvät puremakohtaan sekä syljen että punkin ulosteiden mukana. "
"Puutiaisten lisäksi borreliaa on löytynyt monista muista punkkiryhmistä, jotka imevät verta lämminverisistä selkärankaisista (Steere 1989). Myös monet verta imevät hyönteiset, ennen kaikkea eräät paarmalajit (Hybomitra lasiophthalma ja Chrysops callidus) ja ainakin Pohjois-Amerikassa myös hyttyset, voivat kantaa bakteeria (Magnarelli ja Anderson 1988). Kaikki bakteerinkantajina tunnetut hyönteiset eivät ilmeisestikään välitä borrelioosia ihmiseen, mutta asia on perusteellisemman selvityksen arvoinen. "
"Borrelioosin kliininen kuva ja patogeneesi
Lymen borrelioosin esitetään yleensä etenevän kolmessa vaiheessa lueksen tapaan. Ensimmäinen vaihe käsittää lokaalisen infektion ihossa, toinen infektion disseminoitumisen ja kolmas pysyvän infektion (Steere 1989). On ilmeistä, että Euroopassa tauti ei noudata näin selvää vaiheittaisuutta, vaan jako varhais- ja myöhäisoireisiin vastannee paremmin todellisuutta kuin kategorinen kolmivaiheisuus (Wahlberg ja Granlund 1990). Taulukossa 1 on kuvattu tavallisimpien oireiden esiintymistä eräissä Euroopan maissa ja Yhdysvalloissa (Schmid ym. 1985, Stanek ym. 1988, Schauman ym. 1989). Suomalainen borrelioosi näyttää muistuttavan ruotsalaista tautia (Schauman ym. 1989).
Varhaisoireet ovat ilmeisesti kaikkialla hyvin samankaltaiset. Borrelia leviää muutamassa päivässä puremakohdasta ympäröivään ihoon ja aiheuttaa rengasmaisesti laajenevan erythema migransin (EM) (kuva 4). Taipeiden alueella ja muuallakin eryteema voi esiintyä soikeana tai nauhamaisena. Ihottuma ei yleensä kutia eikä aiheuta kipua. EM:n alue voi laajetessaan rauhoittua keskiosistaan, mutta toisinaan koko alue säilyy punoittavana ja turvonneena. EM häviää yleensä muutamassa viikossa, mutta se voi olla havaittavissa kuukausienkin ajan. Potilaalla saattaa olla kuumetta, päänsärkyä ja epämääräisiä muita särkyjä sekä väsymystä ja paikallista lymfadenopatiaa. Ellei tyypillistä EM:ia ole eikä punkin puremaa ole havaittu, tautia on lähes mahdoton erottaa tavallisista virustaudeista.
EM:n määritelmään kuuluu, että renkaan halkaisijan on ylitettävä 5 cm ja koon kasvettava ripeästi. Tosin endeemisellä alueella ihmiset ovat niin hyvin tietoisia taudista, että he etsivät hoitoa EM:n alkuvaiheessa. Heti pureman jälkeen syntynyt reaktio ei ole EM, vaan johtuu yliherkkyydestä punkin sylkeä kohtaan. Lymphadenosis benigna cutis on erityisesti korvalehden tai nännin alueella esiintyvä melko harvinainen varhaisborrelioosin ihomanifestaatio.
Myöhäisoireet voivat ilmetä viikkoja tai vuosia primaarioireiden jälkeen. Tarkkaan ei tiedetä, kuinka usein tauti jatkuu myöhäisvaiheeseen. On esitetty, että EM-vaihetta seuraisi jopa 50 %:lla potilaista jonkinlaisia myöhäisoireita. Tämä johtaisi huomattavan suuriin sairastumislukuihin esimerkiksi Ahvenanmaalla, missä punkinpureman yhteydessä esiintyy ihomuutoksia 26 %:lla altistuneista eli 17 %:lla väestöstä (Wahlberg 1990).
Myöhäisoireita esiintyy ihon, nivelten, hermokudoksen tai sydämen taholta. Borrelia leviää veriteitse ilmeisesti kaikkialle muualle paitsi keskushermostoon, jonne sen on ajateltu kulkevan perifeerisiä hermoja pitkin. Vaikuttaa ilmeiseltä, että Lymen taudin toisessa vaiheessa potilaalla on rajumpia yleisoireita kuin eurooppalaisen taudin myöhäisvaiheen alussa (Steere 1989). Potilaat voivat myöhäisoireiden alkuvaiheessa myös laihtua rajusti.
Iho-oireet. Yksittäisiä tai useampiakin metastaattisia EM- läiskiä voi ilmaantua myös primaarivaiheen jälkeen, eivätkä ne välttämättä sijaitse alkuperäisessä infektiokohdassa. Sekundaariset eryteemat ovat yleensä pienempiä kuin primaariset ja migroivat vähemmän. Niiden yhteydessä esiintyy usein neurologisia oireita.
Alussa mainittu ACA on borrelian aiheuttama krooninen ihoinfektio, joka voi ilmestyä jopa vuosienkin kuluttua EM-vaiheen jälkeen. Alussa iho turpoaa ja muuttuu sinipunaiseksi mononukleaaristen solujen infiltroituessa dermikseen. Vähitellen dermikseen tulee teleangiektasioita ja se atrofioituu. Iho muuttuu pergamenttimaiseksi ja tummuu. Hoitamattomana prosessi voi jatkua yli kymmenen vuotta ja levitä esimerkiksi koko säären tai reiden alueelle. B. burgdorferi on viljeltävissä ACA-alueen reunasta niin kauan, kuin leesion leviäminen jatkuu (Åsbrink ym. 1984). Bakteeri voi ACA-alueelta levitä suoraan alla tai lähellä oleviin luihin ja niveliin aiheuttaen periostiittia ja subluksaatioita.
Borrelia voi myös aiheuttaa kroonisen pannikuliitin eli ihonalaisen rasvakudoksen infektion. Tauti saattaa jatkua vuosia ja kuumeiset pannikuliittivaiheet voivat toistua muutaman kuukauden välein (Viljanen ym. 1991).
Nivel- ja lihasoireet. Vaihtelevan ajan kuluttua primaarivaiheen jälkeen potilaille voi ilmaantua oligoartriitteja. Ne esiintyvät tavallisimmin suurissa nivelissä, erityisesti polvissa, ja yleensä niitä edeltävät uusiutuvat artralgia- ja myalgiavaiheet (Steere 1989). Joskus artriittioireet esiintyvät jo EM-vaiheen lopussa. Artriiteille on tyypillistä oireettomien ja oireellisten kausien vuorottelu. Tauti kroonistuu noin 10 %:lla potilaista ja saattaa kestää vuosia. Vaikeissa tapauksissa tauti voi johtaa rustoeroosioiden syntymiseen. Harvoin kuitenkaan nivelet vammautuvat pysyvästi.
Eurooppalaisessa borrelioosissa artriittia esiintyy vähemmän kuin amerikkalaisessa taudissa (taulukko 1). Sen sijaan myalgia ja artralgia ovat ainakin suomalaisessa myöhäisborrelioosissa hyvin yleisiä (Schauman ym. 1989, Wahlberg ja Granlund 1990, Wahlberg, henkilökohtainen tiedonanto). Artralgiaa, myalgiaa ja fibromyalgiaa ei kuitenkaan voida pitää borrelioosina ilman serologista tai muuta varmistusta. Sama koskee kroonista etenevää artriittia ja kroonista symmetristä polyartriittia, joita lyhyet uusiutumisvaiheet eivät ole edeltäneet (Ragn ja Malawista 1991).
Borreliaa on eri tekniikoilla, myös viljelyllä (Rawlings ym. 1987), löydetty sekä synoviasta että nivelnesteestä. Kroonisessa toistuvassa artriitissa ei nivelnesteestä yleensä löydy eläviä spirokeettoja. Taudin ajatellaankin syntyvän immunologisella mekanismilla (Steere 1989).
Neurologiset oireet. Lymen taudissa neurologiset oireet ilmenevät pääasiassa aivokalvojen ja aivohermojen alueella eli erilaisina meningoradikuliitteina. Eurooppalaiselle borrelioosille on tyypillistä esiintyminen Bannwarthin syndroomana tunnetussa muodossa (Kovanen ym. 1985, Marttila ja Panelius 1985). Siinä 6-8 viikon kuluttua punkin puremasta alkavat kovat radikulaariset kivut. Ne alkavat usein pureman tai EM:n kohdalta ja siirtyvät jalkoihin ja lanneselkään. Särkyjen esiintyminen hartioissa ja lapaluiden seudussa on myös tavallista. Kivut voivat vaihdella samallakin potilaalla sekä paikaltaan että vaikeudeltaan.
Neurologiset puutokset ilmaantuvat 1-3 viikon kuluessa kipuvaiheen alkamisesta. Ne ovat aivohermojen halvauksia, tavallisimpana kasvohermojen halvaus, tai radikulaarisia halvauksia ja tuntohäiriöitä. Raajahalvaukset ovat yleensä epäsymmetrisiä, mutta para- ja tetrapareesitkin ovat mahdollisia. Oireet paranevat yleensä muutamassa kuukaudessa, mutta pysyviäkin puutoksia esiintyy. Borrelioosia pidetään lasten kasvohermojen halvauksen tärkeimpänä syynä, ja heillä tätä halvausta onkin pidettävä borrelioosina, kunnes toisin osoitetaan (Christen ym. 1990). Erityisen todennäköinen borrelioosi on molemminpuolisessa halvauksessa.
Joskus neurologiset myöhäisoireet ilmaantuvat vasta vuosien kuluttua primaarivaiheesta. Parhaiten tunnettu myöhäistauti on progressiivinen enkefalomyeliitti, joka voi aiheuttaa parapareeseja, rakon toiminnan häiriöitä ja aivohermojen halvauksia. Kun potilaalla ei välttämättä ole ollut mitään varhaisempien vaiheiden oireita, myöhäisoireiden yhdistäminen borrelioosiin voi olla todella vaikeaa.
Päänsärkyä, niskajäykkyyttä, kroonista väsymystä, erilaisia parestesioita, muistihäiriöitä ja anoreksiaa voi esiintyä borrelioosin yhteydessä. Niitä ei kuitenkaan ilman tyypillisempiä oireita tai muuta taudin varmistusta voida pitää borrelioosin aiheuttamina. Sama koskee enkefalopatioita sekä multippeliskleroosia muistuttavia ja muita fokaalisia aivoleesioita.
Sydänoireet. Useiden viikkojen kuluttua primaari-infektiosta muutamalle prosentille potilaista voi kehittyä eriasteisia eteis- kammiokatkoksia, myoperikardiitteja tai lievää vasemman kammion toiminnanvajausta (Steere ym. 1980). Katkokset paranevat yleensä nopeasti eikä pysyvää tahdistinta tarvita. Muutamia kardiomegalia- ja pankardiittitapauksiakin on raportoitu. Kirjallisuudessa on esitetty toistaiseksi vain yksi kuolemaan johtanut pankardiitti (Marcus ym. 1985). Palpitaatiota, bradykardiaa, haarakatkoksia ja myokardiittia voidaan pitää borrelioosin aiheuttamina vain niiden liittyessä tyypilliseen oireeseen tai taudin ollessa muuten varmistettu.
Muut oireet. Edellä on käyty läpi vain borrelioosin pääoireet, jotka aiheutuvat sellaisten elinten sairastumisesta, joihin spirokeetta mieluiten pesiytyy. Disseminaatiovaiheen jälkeen borrelia voi aiheuttaa infektion lähes missä elimessä tahansa. Yksittäistapauksina on kuvattu esimerkiksi hepatiitteja, erilaisia silmänsisäisiä ja -ulkoisia infektioita (Winward ym. 1989) sekä orkiitteja (Steere 1989). Borrelia voi myös levitä sikiöön ja johtaa sikiön kuolemaan (Rahn ja Malawista 1991). Lymen alueella tehdyssä tutkimuksessa ei kuitenkaan todettu yhteyttä synnynnäisten epämuodostumien ja napaveren vasta-ainepitoisuuden välillä (Steere 1989).
Borrelioosin diagnostiikka
Borrelioosin diagnoosi on aina perustaltaan kliininen, mutta tueksi tarvitaan laboratoriotutkimuksia. Perusteellinen anamneesi on borrelioosidiagnostiikan kulmakivi. Punkinpuremaa ja EM:ia kannattaa kysyä parinkin vuoden ajalta. Punkinpureman ja EM:n puuttuminen ei kuitenkaan sulje pois borrelioosia. Myös vierailu endeemisellä alueella kuuluu kysyttäviin asioihin. Aluetta voidaan pitää borrelioosin suhteen endeemisenä, jos siellä esiintyy tautia ja tarvittavia vektoreita. Tällä perusteella Ahvenanmaa, saaristo ja eteläinen rannikkoseutu ovat varmasti endeemisiä alueita. Endeemisellä alueella tulee epämääräisiin oireisiin liittyviin positiivisiin laboratoriotuloksiin suhtautua vakavammin kuin muualla.
Epäspesifisistä laboratoriolöydöksistä tyypillisin on seerumin IgM:n pitoisuuden polyklonaalinen suureneminen. Meningoradikuliitille on tyypillistä likvorin lymfosytaarinen pleosytoosi ja suurentunut proteiinipitoisuus. Proteiinipitoisuus suurenee sekä veri-aivoesteen vaurioitumisen että intratekaalisen immunoglobuliinintuotannon takia.
Käytännössä spesifinen diagnoosi perustuu lähes aina serologiaan."
"Suurena pysyvä IgM- tai IgG-vasta-aineiden pitoisuus viittaa pitkittyneeseen infektioon (Craft ym. 1984). "
"Borreliaan tehoavat monet mikrobilääkkeet (Cryan ja Wright 1990). Hoitosuositukset ovat muuttuneet nopeasti ja muuttuvat todennäköisesti vastakin. Suositukset eivät aina perustu laajoihin ja hyvin kontrolloituihin tutkimuksiin, vaan yleensä lääkkeiden tehokkuuteen in vitro (Rahn ja Malawista 1991). "
"EM:n ja muiden varhaisoireiden hoidossa yleensä riittää suun kautta annettava 2-3 viikon mittainen hoito (Rahn ja Malawista 1991). Nykyisin käypä hoito on amoksisilliini annoksin 1 g x 2. Lapsille annos on 50 mg/kg/vrk. Vaihtoehtoina tulevat kysymykseen doksisykliini annoksin 100 mg x 2 ja lapsille erytromysiini annoksin 30 mg/kg/vrk. Erytromysiinin teho tosin on in vivo heikompi kuin in vitro.
Myöhäisoireiden hoidossa käytettiin aiemmin suuriannoksista, lyhytaikaista penisilliinihoitoa laskimoon. Tämä hoito todettiin kuitenkin melko usein tehottomaksi (Dattwyler ym. 1988a). Vaikka pensilliinihoidolla edelleenkin on kannatusta, suositellaan meningiitin ja muiden keskushermostoinfektioiden, kardiitin ja AV- katkosten sekä artriitin hoitoon keftriaksonia annoksin 2 g x 1 laskimoon 2-3 viikon ajan (Rahn ja Malawista 1991). Yhä ilmeisemmäksi on kuitenkin käynyt, että 2-3 viikon kuurit ovat liian lyhyitä borrelian hoidossa, vaikka käytettäisiin hyvinkin tehokkaita lääkkeitä. Nykyinen suositus myöhäisborrelioosin hoitoon on keftriaksonia seuraava vähintään sadan päivän kuuri amoksisilliinia (0.5 g x 3) yhdessä probenesidin (0.5 g x 3) kanssa (Burrascano 1990).
Lihas- ja niveloireiden hoitoon suositellaan mikrobilääkkeitä, vaikka niiden hyödyllisyydestä ei ole kiistatonta näyttöä (Rahn ja Malawista 1991). Nivelen sisäistä kortikosteroidihoitoa tulee yleensä välttää niin kauan kuin borrelioosia ei ole varmasti suljettu pois, koska steroidit voivat heikentää mikrobilääkkeiden tehoa (Rahn ja Malawista 1991). Kortikosteroideja tulee muissakin tiloissa välttää ennen borrelioosin pois sulkua.
Raskaudenaikaisen borrelioosin hoito on melko kiistanalainen asia. Rahn ja Malawista (1991) suosittelevat laskimoon annettavaa keftriaksonia kaikkien raskaudenaikaisten borrelioosien hoitoon. Vain yksittäinen EM voitaisiin hoitaa suun kautta annettavalla amoksisilliinilla. "
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Duodecim 12/2009
Voiko Lymen borrelioosi kroonistua?
Lääketieteellinen Aikakauskirja Duodecim
2009;125(12):1269-76
Peter Wahlberg ja Dag Nyman
Katsaus
English summary: Chronic Lyme Borreliosis - Fact or Fiction?
Infektion luonne
Infektion vaiheet ja oireisto
Pitkittyneet oireet
Infektion kulku solutasolla
Erotusdiagnostiikan ongelmia
Borreliainfektion toteaminen
Pitkittyneen Lymen taudin hoidon tarve ja periaatteet
Lopuksi
Kirjallisuutta
Lymen borrelioosin oireet voivat pitkittyä monella eri tavalla, joskus kroonistuakin. Jatkuva aktiivinen infektio hoidon jälkeen on Suomessa harvinainen ja silloinkin useimmiten antibioottihoidon puuttumisen tai väärän hoidon seuraus. Suurimmat diagnostiset vaikeudet ovat aktiivisen infektion indikaattoreiden puute ja oireiston monisärmäisyys. Oireita esiintyy tavallisimmin hermostosta ja nivelistä. Vaikka monia johtolankoja on löytynyt, ei tiedetä yksityiskohtaisesti, miksi tulehdus joskus jatkuu pitkään onnistuneenkin hoidon jälkeen. Pitkittyneiden oireiden ehkäisyssä tärkeintä on, että diagnoosi tehdään varhain ja antibioottihoito on suositusten mukainen. Tauti muistuttaa muita sairauksia, ja erotusdiagnostiikka on ratkaisevan tärkeää. Ylipitkiä ja toistuvia antibioottihoitoja pitää karttaa.
English summary: Chronic Lyme Borreliosis - Fact or Fiction?
Persistent infection after proper antibiotic treatment in Lyme borreliosis is rare. Symptoms may sometimes continue, especially from the nervous and the articular systems. There are many possible mechanisms for persistence of inflammation even after successful treatment of the infection. The lack of indicators of active infection impedes diagnostics. Early diagnosis and treatment are the most important means for preventing prolonged symptoms and signs. The differential diagnostics are crucial. Repeated treatment with antibiotics is seldom needed, and overlong treatments should be avoided. Lyme borreliosis may sometimes cause permanent tissue damage for which there is no cure.
Käsite krooninen Lymen tauti on kiistanalainen. Muutama vuosi sitten Yhdysvaltojen päivälehdet kertoivat, että Allen Steere - eräs Lymen borrelioosin (LB) löytäjistä - oli saanut tappouhkauksia, koska hän ei ollut hyväksynyt diagnoosia chronic Lyme disease eikä suostunut antamaan potilaiden vaatimaa antibioottihoitoa.
Eräiden tutkijoiden mielestä hoidetun borrelioosin pitkittyneitä muotoja ei ylipäänsä ole olemassa: "hoidettu potilas on terve". Toisten mielestä tarvitaan kuukausia kestäviä antibioottihoitoja aina, kun borrelioosin oireet uusivat tai pitkittyvät. Cairnsin ja Goodwinin (2005) 504 potilaan ja 530 verrokin meta-analyysi osoitti, että jatkuvaa väsymystä, niveloireita, lihaskipua ja neurokognitiivisia häiriöitä esiintyi merkitsevästi enemmän LB-potilailla kuin verrokeilla. Yhdysvalloissa kiista on pelkistynyt kahden koulukunnan väliseksi, ja kannanotot ovat erittäin jyrkät (Cameron ym. 2004, Wormser ym. 2006, Feder ym. 2007, Halperin ym. 2007). Euroopassa asenteet ovat olleet maltillisempia (Brouqui ym. 2004, Societé de pathologie infectieuse 2007, EUCALB 2008).
Epäselvyys johtuu osaksi käsite-eroista: jotkut tutkijat tarkoittavat termillä krooninen LB vain itse infektion jatkumista, toiset taas kaikkia entisenkin LB-potilaan tuntemia oireita (post-Lyme disease). LB on monikirjoinen, ja sen diagnostiikka ja hoito eivät ole kaavamaisia.
Kukaan ei kiistä, että oireita voi esiintyä LB:n jälkeen, vaikka aktiivinen infektio olisi sammunutkin. Nämä oireet aiheuttavat ongelmia sekä potilaalle että lääkärille. Potilas uskoo, että ne merkitsevät infektion jatkumista, ja lääkärin on vaikeaa perustella, miksi antibiootteja ei tarvita.
Infektion luonne
Puutiaisvälitteinen spirokeettatauti LB on monimuotoinen, monen elinsysteemin tartuntatauti, jonka aiheuttavat Borrelia burgdorferin (Bb) useat eri lajit ja lajien kymmenet variantit. Yhdysvalloissa aiheuttaja on melkein yksinomaan Bb sensu stricto, mutta Suomessa kuten muuallakin Euroopassa B. afzelii ja B. garinii ovat tavallisimmat. Alalajien aiheuttamat kliiniset taudinkuvat eivät ole täysin samanlaisia, ja tämän johdosta Yhdysvaltojen diagnostiikkaa ja hoitoperiaatteita ei voida aina soveltaa Euroopan oloihin.
Oireiden vaihtelevaisuus on LB:n tunnusmerkki. Ensivaiheen erythema migrans on luonteenomainen oire, mutta muuten tauti ansaitsee toiselta spirokeettataudilta syfilikseltä perimänsä lisänimen "suuri matkija". Syy tähän on, että LB:n oireet syntyvät harvoin itse infektiosta; useimmiten ne aiheutuvat niistä reaktioista, joiden avulla elimistö yrittää suojautua.
Taudin maantieteellisesti vaihteleva esiintyvyys vaikeuttaa diagnostiikkaa. Seuduilla, joilla borrelia on endeeminen - esimerkiksi Lounais-Suomessa ja Ahvenanmaalla - terveiltäkin asukkailta usein löytyy serologinen tausta eli subkliinisen tai diagnosoimattoman parantuneen infektion serologisia jälkiä. Yksinkertaista ja varmaa rutiinimenetelmää LB-infektion aktiivisuuden osoittamiseksi ei vieläkään ole saatavissa.
Infektion vaiheet ja oireisto
Jos infektio pääsee disseminoitumaan ihosta muualle elimistöön, se voi aiheuttaa hoitamattomana pitkäaikaisia oireita ainakin hermostosta ja nivelistä. Nämä oireet saattavat jatkua vuosikausia ja aiheuttaa jopa pysyvän työkyvyttömyyden.
Tauti ei aina etene kaikkien vaiheiden läpi vaan voi myös ilmaantua suoraan myöhempien vaiheiden oirein.
Kuva 1. Lymen borrelioosin vaiheet.
Erythema migrans (EM), Bb-infektion tavallisin primaarivaihe, on helppohoitoinen, ja sillä on hyvä ennuste. Jo tässä vaiheessa voi kuitenkin esiintyä disseminaatiota keskushermostoon (Oksi ym. 2001). Hoidon jälkeenkin borrelian DNA:ta saattaa löytyä ihosta jopa kuukausien ajan, ja noin 1 %:ssa tapauksista borreliaspirokeettoja on viljeltävissä eryteema-alueen ihobiopsianäytteistä. Neuroborrelioosia muistuttavia oireita esiintyy 5-20 %:lla antibiooteilla hoitamattomista EM-potilaista yli kuuden kuukauden kuluttua tartunnasta.
Neuroborrelioosi. Valtaosa aikaisista neuroborreliooseista paranee itsestään. Noin kolmanneksella infektio kuitenkin jatkuu hoitamattomana, aiheuttaen myöhäisvaiheen muutoksia. Hyvissä ajoin hoidetun varhaisen neuroborrelioosin oireet rauhoittuvat yleensä nopeasti, ja kokemuksemme mukaan ne tavallisesti häviävät kokonaan parissa viikossa ja infektio paranee. Ljøstadin ja Henriksenin (2008) mukaan pysyvistä oireista (väsymys, keskittymisvaikeudet, kivut) on tosin ilmoitettu jopa 25-50 %:lla potilaista viiden vuoden kuluttua. Suuri määrä johtunee hoitokäytännöstä, ja Suomen oloissa tulokset ovat selvästi paremmat. Toisessa Berglundin ym. (2002) aineistossa arkitoimia haittavia oireita esiintyi 12 %:lla potilaista jopa viisi vuotta hoidon jälkeen.
Sopivan antibioottihoidon jälkeen likvorin solumäärä pienenee muutamassa viikossa. Keskushermoston neuroborrelioosissa intratekaalinen vasta-ainemuodostus voi jatkua kuukausia tai vuosia, vaikka infektio on hoidettu hyvällä tuloksella.
Nivelborrelioosi. Borreliainfektiolle on luonteenomaista, että ilman hoitoa syntyy joidenkin kuukausien kuluttua niveltulehduksia - Yhdysvalloissa noin 60 %:lle potilaista (Steere ym. 1987) ja Euroopassa 15-25 %:lle (Priem ym. 2003, EUCALB 2008). Antibioottihoito useimmiten parantaa ne.
Pitkittyneet oireet
Pitkittyneiden oireiden syyt ovat vain osaksi tunnettuja. Kyseessä voi olla esimerkiksi jatkuva infektio, pysyvä elinvaurio, immuuni-ilmiö tai sytokiininmuodostus. Diagnoosin kannalta on muistettava, että vasta-aineita löytyy usein terveiden LB:tä sairastaneiden seerumista jopa vuosikausia onnistuneenkin hoidon jälkeen (Peltomaa ym. 2003). Sekä potilaalla että spirokeetalla voi olla ominaisuuksia, jotka edistävät oireiden ja paranemattomien kudosvaurioiden syntymistä (Nardelli ym 2008). Ei saa myöskään unohtaa, että tällekin bakteerille voi kehittyä resistenssiä tiettyjä antibiootteja kohtaan (Hunfeld ja Brade 2006).
Kuva 2. Miksi Lymen tauti voi pitkittyä?
Pitkittynyt infektio. Jatkuva spirokeettainfektio asianmukaisen hoidon jälkeen on pitkäaikaisten borreliaoireiden harvinainen syy. LB:n myöhempien vaiheiden suomalaisessa hoitotutkimuksessa (Oksi ym. 2007) hoito todettiin epäonnistuneeksi vuoden kuluttua vain alle 2 %:lla potilaista. Persistoivaa infektiota pidetään kuitenkin edelleen eräänä mahdollisena syynä borreliainfektion jälkeisen krooniseen tulehdukseen.
Spirokeetalla on monta keinoa elimistön puolustusmekanismien välttämiseksi (Alitalo 2004). Esimerkkejä ovat mm. antigeeninvaihto, komplementtisysteemin välittämän bakteeri-inaktivaation estäminen ja elimistön proteaasien käyttö avaimena kudokseen pääsemiseksi. Spirokeetta voi välttää tai vähentää antibioottien vaikutusta piiloutumalla kudoksiin (esim. jänteisiin) ja soluihin, joihin antibiootit tunkeutuvat huonosti. On myös esitetty hypoteesi, että se voisi muuttua heikosti aktiiviseksi ja antibiootteja sietäväksi, mm. kystiseksi muodoksi, mutta riittävää dokumentaatiota ei ole esitetty.
Sekä eri Bb-lajeilla että eri potilailla voi olla ominaisuuksia, jotka edistävät infektion leviämistä ja pitkittymistä. RST1-ryhmään kuuluva Bb (rRNA gene spacer restriction fragment length polymorphism genotype) on erittäin virulentti, aikaansaa erityisen rajun tulehduksen ja disseminoituu kudoksiin helpommin kuin muiden RST-ryhmien borreliat. Tämä voi edistää infektion jatkumista.
Borrelian pintalipoproteiineja sitoutuu Tollin kaltaisten reseptorien kompleksiin (TLR) 1/2, ja ne käynnistävät Th1-solureaktion. TLR-polymorfismi vaikuttaa borreliainfektion aiheuttamien reaktioiden kirjoon sekä eläimillä että ihmisillä.
Pitkittyneet neuroborrelioosioireet. Borrelia aktivoi mikrogliaa, joka muodostaa merkkiaineita, kuten interleukiini 6:ta, tuumorinekroositekijä alfaa ja prostaglandiini E2:ta sekä lisää TLR:n ja lipopolysakkaridia sitovan makrofagireseptorin CD14:n ilmentymistä (Rasley ym. 2002). Infektion aikaansaamat perivaskulaariset tiivistymät voivat häiritä paikallista verenkiertoa. Ristireaktioita borreliavasta-aineiden ja hermokudoksen välillä esiintyy, samoin adaptiivista vastetta suoraan hermokudosta kohtaan ilman ristireaktiota.
Jatkuva niveltulehdus. Persistoiva antibiootteihin reagoimaton artriitti on Euroopassa harvinainen oire. Yhdysvalloissa sitä vastoin se syntyy noin 10 %:lle. Niveltulehdus jatkuu samassa nivelessä kuukausia, vuosiakin. Usein on kyseessä ison nivelen - esimerkiksi polvinivelen - monoartriitti.
Luonteenomaisia löydöksiä ovat synoviakudoksen paksuuntuminen ja makrofagi- ja T-soluinfiltraatio (pääasiassa CD4+ Th1-soluja ja myös CD20+B-soluja). Nivelessä on nestettä, joka sisältää runsaasti soluja, varsinkin liuskatumaisia neutrofiileja. Borreliaviljely- ja PCR-löydös ovat negatiiviset, mutta veressä esiintyy borrelian pintaproteiinin OspA:n vasta-aineita. Endoskooppinen synovektomia voi olla tuloksekas hoitokeino (Steere ym. 2006, Steere ja Angelis 2006).
Autoimmuuni-ilmiöitä on laajalti etsitty pitkittyneen niveltulehduksen mekanismeiksi (Steere ym. 2006). Yhdysvalloissa suoritettujen OspA-antigeenirokotusten komplikaationa ilmeni joillakin rokotetuilla niveltulehduksia. Valtaosalla oli HLA-DRB1*0401-alleeli. Kyseessä on voinut olla samankaltaisuus (molecular mimicry) borrelian OspA:n aminohapposekvenssin 165-175 ja miltei identtisen sekvenssin ihmisen LFA-1-antigeenin välillä. Tällä OspA-sekvenssillä on voimakas affiniteetti HLADRB1*0401-molekyyliin. Kyseinen ilmiö ei ainakaan yksinomaan ole borrelian hoidon jälkeisen tulehduksen laukaisija. Se koskenee vain borrelialajia Bb sensu stricto, eikä sitä siis voida soveltaa laajemmalti eurooppalaisiin potilaisiin. Täällä B. afzelii ja garinii dominoivat ja kuitenkin esiintyy - joskin harvemmin kuin Yhdysvalloissa - potilaita, joilla on antibiootteihin reagoimaton niveltulehdus.
Antibioottiherkässä Bb sensu stricto -infektiossa OspA-spesifisten T-solujen lukumäärä nivelessä on ennen hoitoa suuri ja pienee hoidon jälkeen, vaikka resistentti tulehdus kehittyisikin, joten nämä solut tuskin ovat ratkaisevia tekijöitä kroonisen tulehduksen syntymässä (Kannian ym. 2007).
Toiseksi jatkuvan niveltulehduksen syyksi on esitetty, että pieni määrä spirokeetta-antigeenia nivelpussissa voisi ylläpitää tulehdusprosessia. Vaihtoehtoisesti tällainen mikroinfektio voisi laukaista autoimmuunivasteen, mikä tapahtuisi edellä mainitun molekyylien samankaltaisuuden tai T-solujen aktivoinnin kautta. Nivelnesteestä ja nivelpussista tehty PCR-tutkimus antaa kuitenkin melkein aina negatiivisen tuloksen, eikä borreliaviljelykään niistä onnistu. Kun sitä paitsi vasta-ainepitoisuudet pienenevät merkitsevästi antibioottihoidon jälkeen mutta niveltulehdus kuitenkin jatkuu, tämä mikroinfektioilmiö on epätodennäköinen tulehduksen syy (Drouin ym. 2008).
Infektion kulku solutasolla
Lukuisat hiirillä tehdyt kokeet valottavat Bb-infektion kulkua. Bakteerin viesti kulkee solun sisälle adaptorin MyD88 kautta. Tämän adaptorin puute vaikuttaa infektion sytokiinivasteeseen, jolloin infektio leviää tavallista helpommin. Kun adaptori puuttuu, antigeenispesifistä Th1-vastetta ei synny (Bockenstedt ym. 2006). Tästä seuraa, että Th2-soluvaste Bb-infektioon on tällöin vastaavasti vahvempi ja pitkäaikainen ja antibiooteille resistentti infektio voi kehittyä.
Reseptori CD28:n puuttuessa kehittyy usein krooninen niveltulehdus Bb-infektion jälkeen, ja samalla muodostuu OspA:n vasta-aineita (Iliopoulou ym. 2008). Siirtogeenisillä hiirillä yhdistelmä CD28 -/- ja HLA-DR4 +/+ aiheuttaa aina pysyvän niveltulehduksen. Voimakasta Th1-vastetta ja sitä seuraavaa heikohkoa Th2-vastetta on esitetty paranemisen ehdoksi ihmisillä (Jarefors ym. 2007).
Kuva 3. T-solujen aktivaatio. Ensin Th1-immunireaktiot stimuloituvat, ja sen jälkeen tapahtuu niiden vaimennussäätely (down-regulation) ja Th2-vaste syntyy. A) Kostimulaation kautta tavanomaisen MHC + antigeeni + T-solureseptori (TSR-) kompleksin lisäksi antigeenia esittelevän solun (APC) ligandi B7 reagoi T-solun kostimulaattorin CD28-molekyylin kanssa. T-solu proliferoituu ja erilaistuu. Th1-reaktio tuottaa sytokiineja kuten gammainterferonia ja interleukiini 2. B) B7 reagoi myöhemmin reseptorin CTLA-4 kanssa (cytotoxic Tlymphocyte associated antigen 4), jolloin tapahtuu vaimennussäätely ja Th1-solun inaktivaatio. MHC = major histocompability complex.
Tartutettaessa C3H/He-hiiriä Bb sensu strictolla ja B. gariniilla syntyy levinnyt infektio pitkäaikaisine niveloireineen. Antibioottihoidon jälkeen spirokeettoja ei enää voida PCR:llä eikä viljelyllä osoittaa mutta oireet jatkuvat edelleen. Anti-TNF:n annon jälkeen voidaan kuitenkin taas viljelemällä todeta spirokeettoja koe-eläimissä (Yrjänäinen ym. 2007).
Kysymys, miksi borreliainfektion käynnistämä tulehdus voi jatkua pitkän aikaa hoidon jälkeen, on siis edelleen yksityiskohdiltaan vastausta vailla. Ilmiö riippuu monista elimistön puolustusmekanismeista, kuten TLR-polymorfismista, soluaktivaatiosta ja HLADRB1-alleleista (Iliopoulou ym. 2008).
Erotusdiagnostiikan ongelmia
On mahdotonta luetella kaikkia LB:n erotusdiagnostisia kompastuskiviä. Esimerkiksi nopean dementoitumisen on todettu voivan johtua LB:sta ja parantua täysin antibioottihoidon avulla. Toisaalta esimerkiksi perifeerisille halvauksille saattaa olla Bb-positiivisella potilaalla muitakin syitä kuin LB. Niveltulehdus voi myös johtua muusta kuin LB:stä vaikka Bb-seroreaktio olisikin positiivinen. Nivelreuman monet esiintymismuodot sekä muun muassa reaktiivinen artriitti, on otettava huomioon.
Borreliainfektion toteaminen
Aktiivisen Bb-infektion varmaa objektiivista indikaattoria ei ole lukuun ottamatta spirokeetan viljelyä. Pitkittyneiden oireiden diagnostiikassa lähtökohtana ovat aina kliiniset oireet ja löydökset ja tämän jälkeen seuraavat samat serologiset tutkimukset kuin muutenkin LB:ssä (EUCALB 2008, Wahlberg ja Nyman 2008), perustana VlsE C6 -vasta-aineanalyysi ja Western blot -varmistus. LB-diagnostiikassa hoitavan lääkärin ei yleensäkään pitäisi koskaan tyytyä mitäänsanomattomaan laboratoriovastaukseen "Borrelia plus" vaan laboratorion tulee antaa selkeä ja kantaa ottava lausunto, joka suhteutetaan aikaisempiin löydöksiin. Jos oireet ja serologinen tulos sopivat aktiiviseen infektioon, harkitaan lisävarmistusta esimerkiksi laajentamalla Western blot -nauhakirjoa. Positiivinen PCR-löydös on käyttökelpoinen varmistus. Viljely olisi vielä parempi mutta edelleen kliinisen todellisuuden ulottumattomissa.
Erotusdiagnostiikalla on keskeinen merkitys. Esimerkiksi aivojen tietokonetomografian tai magneettitutkimuksen laiminlyöminen voi olla kohtalokasta, jos potilaalla on keskushermoston oireita, jotka voivat viitata muuhun sairauteen LB:n sijasta tai sen lisäksi.
Pitkittyneen Lymen taudin hoidon tarve ja periaatteet
Yhdysvaltalaisessa hoitokokeilussa (Klempner ym. 2001) annettiin antibioottia tai lumelääkettä valikoimattomille erilaisia psykologisia ja neurologisia oireita poteville, sekä seronegatiivisille että seropositiivisille, jotka olivat aikaisemmin saaneet "suositeltuja" antibioottikuureja LB:n takia. Kliiniseen diagnoosiin ei pyritty, joten kokeilun suoritus eroaa huomattavasti nykyisistä hoitoperiaatteista. Antibiootti- ja lumeryhmien tulosten välillä ei ollut eroja. Myöhemminkin on raportoitu tuloksettomista yrityksistä hoitaa LB:n jälkeisiä väsymystiloja antibiooteilla.
Asianmukaisesti jo hoidettujen potilaiden pitkittyneitä LB:n oireita ei pidä refleksimäisesti hoitaa uudestaan antibiooteilla, vaan aktiivinen infektio on aina pyrittävä varmistamaan parhaalla käytettävissä olevalla tavalla. Jos toisaalta potilaan aikaisemmin saama antibioottihoito ei ole ollut ohjeiden mukainen, annetaan herkemmin säännönmukainen hoito kuten uudessa infektiossa.
Jos potilas on huolissaan infektion jatkumisesta ja aktiivinen infektio ei ole pois suljettavissa, voidaan harkita toisen antibioottihoidon antamista. Potilaalle on kerrottava, että kyseessä on hoitokokeilu, jota ei toisteta.
Tarinanluonteisten potilaskokemusten mukaisia ylipitkiä antibioottihoitojaksoja (jopa yli 6 kuukautta) ei suositella jo ennestään asianmukaisesti hoidetuille potilaille.
Kuva 4. Lymen borrelioosin pitkittyneiden oireiden käsittelyn vaihtoehtoja. Bb = Borrelia burgdorferi.
Lopuksi
Vastaus tämän katsauksen otsikon kysymykseen on myönteinen: Lymen borrelioosi (tai oikeammin Lymen tauti) voi kroonistua, tosin vain harvoin varsinaisena spirokeettainfektiona.
Hoidotta jäämisen tai hoidon vajavaisuuden vuoksi jatkuva infektio on varteenotettava mahdollisuus. Tällöin disseminoitunut aktiivinen borreliaspirokeettainfektio aiheuttaa pitkäaikaisia oireita varsinkin hermostosta ja nivelistä. Ne voivat jatkua vuosikausia aiheuttaen jopa pysyvän työkyvyttömyyden.
Asianmukaisen hoidon jälkeisten oireiden syynä aktiivinen infektio on harvinainen. Kroonisen infektion tärkeimmäksi syyksi nousee siis LB:n diagnoosin ja hoidon laiminlyöminen tai myöhästyminen. Uuden borreliainfektion mahdollisuutta ei pidä myöskään unohtaa!
Vaikka hoidetun LB:n myöhäisiä oireita laajalti liioitellaankin, on tosiasia, että LB voi aiheuttaa vuosikausia jatkuvia vaivoja. Useimmin oireilla on jokin muu syy kuin jatkuva infektio. LB:n käynnistämien oireiden patogeneesi vaihtelee; immunologiset mekanismit ja pysyvä elinvaurio ovat tavallisimmat.
LB:n diagnoosin ja hoidon viivästyminen viikoilla tai kuukausilla huonontaa ennustetta ja lisää pysyvien elinvaurioiden riskiä. Toisaalta on vältettävä hätiköityä antibioottihoitoa ilman mahdollisimman varmaa diagnoosia. Antibiooteilla hoidetaan vain infektioita!
LB voi muistuttaa monia muita sairauksia, ja monet muut sairaudet voivat tämän takia muistuttaa LB:ta, eli yli- ja alidiagnostiikan vaara on ilmeinen. Endemia-alueilla yleisesti esiintyvät myönteiset Bb-seroreaktiot saattavat viedä hakoteille. On ensiarvoisen tärkeää pohtia tarkoin erotusdiagnostiikkaa. Tämän laiminlyöminen voi käydä kohtalokkaaksi.
LB on monessa osassa Suomea kansantauti, joka aiheuttaa runsaasti pitkäaikaistakin työkyvyttömyyttä. Sitä on esiintynyt Suomessa yli 100 vuoden ajan. Ei voi olla pohtimatta, kuinka paljon tämä tauti ennen sen syyn löytämistä on mahtanut vaikuttaa kansan terveyteen ja sairastavuuteen. Tämä on jokaiselle lääkärille aprikoinnin - ja nöyryyden - aihe.
PETER WAHLBERG, LKT, professori
Åsvägen 14-B
22100 Mariehamn
DAG NYMAN, LT, professori
Tingebergsvägen 31
22150 Jomala
Kirjallisuutta
Alitalo A. Complement evasion by borrelia burgdorferi spirochetes. Väitöskirja, Helsingin yliopisto 2004.
Berglund J, Stjernberg L, Ornstein Tykesson-Joelsson K, Hallstein W. 5-y follow-up study of patients with neuroborreliosis. Scand J Infect Dis 2002;34:421-5.
Bockenstedt LK, Liu N, Schwartz J, Fish D. MyD88 deficiency enhances acquisition and transmission of borrelia burgdorferi by Ixodes scapularis ticks. Infect Immun 2006;74:2154-60.
Brouqui P, Bacellar F, Baranton G, ym. Guidelines for the diagnosis of tick-borne bacterial diseases in Europe. Clin Microbiol Infect 2004;10:1108-32.
Cairns V, Goodwin J. Post-Lyme borreliosis syndrome: a meta-analysis of reported syndromes. Int J Epidemiol 2005;34:1340-5.
Cameron D, Gaito A, Harris N, ym. Evidence-based guidelines for the management of Lyme disease. The International Lyme and Associated Diseases Society. Expert Rev Anti Infect Ther 2004;2 Suppl:1-13.
Drouin EE, Glickstein L, Kwok WW, Nepom GT, Steere AC. Human homologues of a Borrelia T cell epitope associated with antibiotic-refractory Lyme arthritis. Mol Immunol 2008;45:180-9.
EUCALB (European Union Concerted Action on Lyme Borreliosis) 2008. http://meduni09.edis.at/eucalb/cms/index.php?lang=en
Feder HM, Johnson BJB, Connell S, Shapiro ED. Steere AC, Wormser GP. A Critical appraisal of "Chronic Lyme Disease". N Engl J Med 2007;357:1422-30.
Halperin JJ, Shapiro ED, Logigian E, ym. Practice Parameter: Treatment of nervous system Lyme disease (an evidence-based review). Neurology 2007;69:91-102.
Hunfeld KP, Brade V. Antimicrobial susceptibility of Borrelia burgdorferi sensu lato: what we know, what we don't know, and what we need to know. Wien Klin Wochenschr 2006;118:659-68.
Hytönen J, Hartiala P, Oksi J, Viljanen MK. Borreliosis: recent research, diagnosis and management. Scand J Rheumatol 2008;37:161-72.
Iliopoulou BP, Alroy J, Huber BT. Persistent arthritis in Borrelia burgdorferi-infected HLA-DR4-positive CD28-negative mice post-antibiotic treatment. Arthritis Rheum 2008;58:3892-901.
Jarefors S, Janefjord CK, Forsberg P, Jernmalm MC, Ekerfelt C. Decreased up-regulation of the interleukin-12Rb2-chain and interferon-gamma secretion and increased number of forkhead box P3-expressing cells in patients with a history of chronic Lyme borreliosis compared with asymptomatic Borrelia-exposed individuals. Clin Exp Immunol 2007;147:18-27.
Kannian P, Drouin E, Glickstein L, Kwok WW, Nepom GT, Steere AC. Decline in frequencies of Borrelia burgdorferi OspA161-175 specific T cells after antibiotic therapy in HLA-DRB1*0401-positive patients with antibiotic-responsive or antibiotic refractory Lyme arthritis. J Immunol 2007;179:6336-42.
Klempner MS, Linden T, Evans J, ym. Two control trials of antibiotic treatment in patients with persistent symptoms and a history of Lyme disease. N Engl J Med 2001;345:85-92.
Ljøstad U, Henriksen TH. Management of neuroborreliosis in European adult patients. Act Neurol Scand 2008;117:22-8.
Nardelli DT, Callister SM, Schell RF. Lyme arthritis, current concepts and a change in paradigm. Clin Vaccine Immunol 2008;15:21-34.
Oksi J, Marttila H, Soini H, Aho H, Uksila J, Viljanen MK. Early dissemination of Borrelia burgdorferi without generalized symptoms in patients with erythema migrans. APMIS 2001;109:581-8.
Oksi J, Nikoskelainen J, Hiekkanen H, ym. Duration of antibiotic treatment in disseminated Lyme borreliosis: a double-blind, randomized, placebo-controlled, multicenter clinical study. Eur J Clin Microbiol Infect Dis 2007;26:571-81.
Peltomaa M, McHugh G, Steere AC. Persistense of the antibody response to the VlsE sixth invariant region (IR6)peptide) of Borrelia burgdorferi after succesful treatment of Lyme disease. J Infect Dis 2003;187:1178-86.
Priem S, Munkelt K, Franz JK, ym. Epidemiologie und Therapie det Lyme-Arthritis und anderer Manifestationen der Lyme-Borreliose in Deutschland. Z Rheumatol 2003;62:450-8.
Rasley A, Anguita J, Marriott I. Borrelia burgdorferi induces inflammatory mediator production by murine microglia. J Neuroimmunol 2002;130:22-31.
Sharpe AH, Abbas AK. T-cell costimulation - biology, therapeutic potential and challenges. N Engl J Med 2006;355:973-5.
Societé de pathologie infectieuse de langue Française. Borréliose de Lyme: démarches diagnostiques, thérapeutiques et préventives. Medecine et maladies infectieuses 2007;37 Suppl 3:153-74.
Steere AC, Angelis SM. Therapy for Lyme arthritis: strategies for the treatment of antibiotic-refractory arthritis. Arthritis Rheum 2006;54:3079-86.
Steere AC, Klitz W, Drouin EE, ym. Antibiotic-refractory Lyme arthritis is associated with HLA-DR molecules that bind a Borrelia burgdorferi peptide. J Exp Med 2006; 203:961-71.
Steere AC, Schoen RT, Taylor E. Lyme arthritis. Ann Intern med 1987;107:725-31.
Wahlberg P, Nyman D. Lymen borrelioosi. Kirjassa: Kunnamo I, toim. Lääkärin käsikirja 2008. Helsinki: Kustannus Oy Duodecim 2008, s. 17-20.
Wormser GP, Dattwyler RJ, Shapiro ED, ym. The clinical assessment, treatment and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: Clinical practical puidelines by the Infectious Diseases Society of America. Clin Infect Dis 2006;43:1089-134.
Yrjänäinen H, Hytönen J, Song XR, Oksi J, Hartiala K, Viljanen MK. Anti tumor-necrosis factor-alpha treatment activates Borrelia burgdorferi spirochetes 4 weeks after ceftriaxone treatment in C3H/He mice. J Infect Dis 2007;195:1489.
"Lymen borrelioosi
Duodecim
1992;108(9):846
Matti K. Viljanen, Pekka T. Lehtinen
Lymen borrelioosi on Suomessakin merkittävä kansanterveysongelma. Borrelioosin leviämistapojen ja oireiden hyvä tuntemus on taudin ehkäisyn ja hoidon perusta. Varhaisborrelioosin diagnosointi perustuu anamneesiin ja kliinisiin oireisiin; myöhäisborrelioosin diagnostiikassa serologian tehokkuus on tärkeää. Erityistapauksissa voidaan käyttää viljelyä ja uusia DNA-tekniikoita. Varhaisborrelioosi voidaan hoitaa avohoidossa. Sen tyyppioire, erythema migrans (EM), edellyttää aina mikrobilääkehoitoa. Myöhäisborrelioosi voi vaatia pitkiäkin hoitokuureja, jotka on käynnistettävä keskussairaalatasoisessa hoitopaikassa. Borrelioosin patogeneesissa on vielä paljon tuntemattomia seikkoja. Potilaan geneettiset tekijät todennäköisesti vaikuttavat siihen, minkälaisen taudin borrelia hänessä aiheuttaa. "
"Borrelia burgdorferi
Borreliat kuuluvat yhdessä treponeemojen ja leptospirojen kanssa spirokeettojen heimoon. Borreliat ovat muita spirokeettoja pidempiä ja kierteisyydeltään epämääräisempiä. B. burgdorferi on pisin (20-30 mm) ja ohuin (0.2-0.3 mm) borrelia. Bakteeri voi joskus kasvaa kierteettömänä rihmana ja muodostaa monimutkaisia vyyhtejä (kuva 14) (Aberer ym. 1991).
Borrelioiden ulkokalvo on perusrakenteeltaan gramnegatiivisten bakteerien ulkokalvon kaltainen. Se on kuitenkin hyvin liikkuva ja voi siirtyä bakteerisolun toiseen päähän bakteerin elintoimintojen siitä kärsimättä. Tämä "cappingiksi" kutsuttu ilmiö ilmeisesti auttaa borreliaa kiinnittymään kohdesoluihinsa (Barbour ja Hayes 1986). Ulkokalvosta irtoaa myös runsain määrin vaihtelevan kokoisia pallosia eli "blebsejä".
Borrelioiden flagellat sijaitsevat monista muista bakteereista poiketen solukalvon ja ulkokalvon välissä. Ne liikuttavat bakteeria aiheuttamalla porautuvan liikkeen. "
"Borrelia kasvaa puutiaisen ohutsuolessa ja kulkeutuu sieltä sylkirauhaseen (Barbour ja Hayes 1986). Spirokeetat siirtyvät puremakohtaan sekä syljen että punkin ulosteiden mukana. "
"Puutiaisten lisäksi borreliaa on löytynyt monista muista punkkiryhmistä, jotka imevät verta lämminverisistä selkärankaisista (Steere 1989). Myös monet verta imevät hyönteiset, ennen kaikkea eräät paarmalajit (Hybomitra lasiophthalma ja Chrysops callidus) ja ainakin Pohjois-Amerikassa myös hyttyset, voivat kantaa bakteeria (Magnarelli ja Anderson 1988). Kaikki bakteerinkantajina tunnetut hyönteiset eivät ilmeisestikään välitä borrelioosia ihmiseen, mutta asia on perusteellisemman selvityksen arvoinen. "
"Borrelioosin kliininen kuva ja patogeneesi
Lymen borrelioosin esitetään yleensä etenevän kolmessa vaiheessa lueksen tapaan. Ensimmäinen vaihe käsittää lokaalisen infektion ihossa, toinen infektion disseminoitumisen ja kolmas pysyvän infektion (Steere 1989). On ilmeistä, että Euroopassa tauti ei noudata näin selvää vaiheittaisuutta, vaan jako varhais- ja myöhäisoireisiin vastannee paremmin todellisuutta kuin kategorinen kolmivaiheisuus (Wahlberg ja Granlund 1990). Taulukossa 1 on kuvattu tavallisimpien oireiden esiintymistä eräissä Euroopan maissa ja Yhdysvalloissa (Schmid ym. 1985, Stanek ym. 1988, Schauman ym. 1989). Suomalainen borrelioosi näyttää muistuttavan ruotsalaista tautia (Schauman ym. 1989).
Varhaisoireet ovat ilmeisesti kaikkialla hyvin samankaltaiset. Borrelia leviää muutamassa päivässä puremakohdasta ympäröivään ihoon ja aiheuttaa rengasmaisesti laajenevan erythema migransin (EM) (kuva 4). Taipeiden alueella ja muuallakin eryteema voi esiintyä soikeana tai nauhamaisena. Ihottuma ei yleensä kutia eikä aiheuta kipua. EM:n alue voi laajetessaan rauhoittua keskiosistaan, mutta toisinaan koko alue säilyy punoittavana ja turvonneena. EM häviää yleensä muutamassa viikossa, mutta se voi olla havaittavissa kuukausienkin ajan. Potilaalla saattaa olla kuumetta, päänsärkyä ja epämääräisiä muita särkyjä sekä väsymystä ja paikallista lymfadenopatiaa. Ellei tyypillistä EM:ia ole eikä punkin puremaa ole havaittu, tautia on lähes mahdoton erottaa tavallisista virustaudeista.
EM:n määritelmään kuuluu, että renkaan halkaisijan on ylitettävä 5 cm ja koon kasvettava ripeästi. Tosin endeemisellä alueella ihmiset ovat niin hyvin tietoisia taudista, että he etsivät hoitoa EM:n alkuvaiheessa. Heti pureman jälkeen syntynyt reaktio ei ole EM, vaan johtuu yliherkkyydestä punkin sylkeä kohtaan. Lymphadenosis benigna cutis on erityisesti korvalehden tai nännin alueella esiintyvä melko harvinainen varhaisborrelioosin ihomanifestaatio.
Myöhäisoireet voivat ilmetä viikkoja tai vuosia primaarioireiden jälkeen. Tarkkaan ei tiedetä, kuinka usein tauti jatkuu myöhäisvaiheeseen. On esitetty, että EM-vaihetta seuraisi jopa 50 %:lla potilaista jonkinlaisia myöhäisoireita. Tämä johtaisi huomattavan suuriin sairastumislukuihin esimerkiksi Ahvenanmaalla, missä punkinpureman yhteydessä esiintyy ihomuutoksia 26 %:lla altistuneista eli 17 %:lla väestöstä (Wahlberg 1990).
Myöhäisoireita esiintyy ihon, nivelten, hermokudoksen tai sydämen taholta. Borrelia leviää veriteitse ilmeisesti kaikkialle muualle paitsi keskushermostoon, jonne sen on ajateltu kulkevan perifeerisiä hermoja pitkin. Vaikuttaa ilmeiseltä, että Lymen taudin toisessa vaiheessa potilaalla on rajumpia yleisoireita kuin eurooppalaisen taudin myöhäisvaiheen alussa (Steere 1989). Potilaat voivat myöhäisoireiden alkuvaiheessa myös laihtua rajusti.
Iho-oireet. Yksittäisiä tai useampiakin metastaattisia EM- läiskiä voi ilmaantua myös primaarivaiheen jälkeen, eivätkä ne välttämättä sijaitse alkuperäisessä infektiokohdassa. Sekundaariset eryteemat ovat yleensä pienempiä kuin primaariset ja migroivat vähemmän. Niiden yhteydessä esiintyy usein neurologisia oireita.
Alussa mainittu ACA on borrelian aiheuttama krooninen ihoinfektio, joka voi ilmestyä jopa vuosienkin kuluttua EM-vaiheen jälkeen. Alussa iho turpoaa ja muuttuu sinipunaiseksi mononukleaaristen solujen infiltroituessa dermikseen. Vähitellen dermikseen tulee teleangiektasioita ja se atrofioituu. Iho muuttuu pergamenttimaiseksi ja tummuu. Hoitamattomana prosessi voi jatkua yli kymmenen vuotta ja levitä esimerkiksi koko säären tai reiden alueelle. B. burgdorferi on viljeltävissä ACA-alueen reunasta niin kauan, kuin leesion leviäminen jatkuu (Åsbrink ym. 1984). Bakteeri voi ACA-alueelta levitä suoraan alla tai lähellä oleviin luihin ja niveliin aiheuttaen periostiittia ja subluksaatioita.
Borrelia voi myös aiheuttaa kroonisen pannikuliitin eli ihonalaisen rasvakudoksen infektion. Tauti saattaa jatkua vuosia ja kuumeiset pannikuliittivaiheet voivat toistua muutaman kuukauden välein (Viljanen ym. 1991).
Nivel- ja lihasoireet. Vaihtelevan ajan kuluttua primaarivaiheen jälkeen potilaille voi ilmaantua oligoartriitteja. Ne esiintyvät tavallisimmin suurissa nivelissä, erityisesti polvissa, ja yleensä niitä edeltävät uusiutuvat artralgia- ja myalgiavaiheet (Steere 1989). Joskus artriittioireet esiintyvät jo EM-vaiheen lopussa. Artriiteille on tyypillistä oireettomien ja oireellisten kausien vuorottelu. Tauti kroonistuu noin 10 %:lla potilaista ja saattaa kestää vuosia. Vaikeissa tapauksissa tauti voi johtaa rustoeroosioiden syntymiseen. Harvoin kuitenkaan nivelet vammautuvat pysyvästi.
Eurooppalaisessa borrelioosissa artriittia esiintyy vähemmän kuin amerikkalaisessa taudissa (taulukko 1). Sen sijaan myalgia ja artralgia ovat ainakin suomalaisessa myöhäisborrelioosissa hyvin yleisiä (Schauman ym. 1989, Wahlberg ja Granlund 1990, Wahlberg, henkilökohtainen tiedonanto). Artralgiaa, myalgiaa ja fibromyalgiaa ei kuitenkaan voida pitää borrelioosina ilman serologista tai muuta varmistusta. Sama koskee kroonista etenevää artriittia ja kroonista symmetristä polyartriittia, joita lyhyet uusiutumisvaiheet eivät ole edeltäneet (Ragn ja Malawista 1991).
Borreliaa on eri tekniikoilla, myös viljelyllä (Rawlings ym. 1987), löydetty sekä synoviasta että nivelnesteestä. Kroonisessa toistuvassa artriitissa ei nivelnesteestä yleensä löydy eläviä spirokeettoja. Taudin ajatellaankin syntyvän immunologisella mekanismilla (Steere 1989).
Neurologiset oireet. Lymen taudissa neurologiset oireet ilmenevät pääasiassa aivokalvojen ja aivohermojen alueella eli erilaisina meningoradikuliitteina. Eurooppalaiselle borrelioosille on tyypillistä esiintyminen Bannwarthin syndroomana tunnetussa muodossa (Kovanen ym. 1985, Marttila ja Panelius 1985). Siinä 6-8 viikon kuluttua punkin puremasta alkavat kovat radikulaariset kivut. Ne alkavat usein pureman tai EM:n kohdalta ja siirtyvät jalkoihin ja lanneselkään. Särkyjen esiintyminen hartioissa ja lapaluiden seudussa on myös tavallista. Kivut voivat vaihdella samallakin potilaalla sekä paikaltaan että vaikeudeltaan.
Neurologiset puutokset ilmaantuvat 1-3 viikon kuluessa kipuvaiheen alkamisesta. Ne ovat aivohermojen halvauksia, tavallisimpana kasvohermojen halvaus, tai radikulaarisia halvauksia ja tuntohäiriöitä. Raajahalvaukset ovat yleensä epäsymmetrisiä, mutta para- ja tetrapareesitkin ovat mahdollisia. Oireet paranevat yleensä muutamassa kuukaudessa, mutta pysyviäkin puutoksia esiintyy. Borrelioosia pidetään lasten kasvohermojen halvauksen tärkeimpänä syynä, ja heillä tätä halvausta onkin pidettävä borrelioosina, kunnes toisin osoitetaan (Christen ym. 1990). Erityisen todennäköinen borrelioosi on molemminpuolisessa halvauksessa.
Joskus neurologiset myöhäisoireet ilmaantuvat vasta vuosien kuluttua primaarivaiheesta. Parhaiten tunnettu myöhäistauti on progressiivinen enkefalomyeliitti, joka voi aiheuttaa parapareeseja, rakon toiminnan häiriöitä ja aivohermojen halvauksia. Kun potilaalla ei välttämättä ole ollut mitään varhaisempien vaiheiden oireita, myöhäisoireiden yhdistäminen borrelioosiin voi olla todella vaikeaa.
Päänsärkyä, niskajäykkyyttä, kroonista väsymystä, erilaisia parestesioita, muistihäiriöitä ja anoreksiaa voi esiintyä borrelioosin yhteydessä. Niitä ei kuitenkaan ilman tyypillisempiä oireita tai muuta taudin varmistusta voida pitää borrelioosin aiheuttamina. Sama koskee enkefalopatioita sekä multippeliskleroosia muistuttavia ja muita fokaalisia aivoleesioita.
Sydänoireet. Useiden viikkojen kuluttua primaari-infektiosta muutamalle prosentille potilaista voi kehittyä eriasteisia eteis- kammiokatkoksia, myoperikardiitteja tai lievää vasemman kammion toiminnanvajausta (Steere ym. 1980). Katkokset paranevat yleensä nopeasti eikä pysyvää tahdistinta tarvita. Muutamia kardiomegalia- ja pankardiittitapauksiakin on raportoitu. Kirjallisuudessa on esitetty toistaiseksi vain yksi kuolemaan johtanut pankardiitti (Marcus ym. 1985). Palpitaatiota, bradykardiaa, haarakatkoksia ja myokardiittia voidaan pitää borrelioosin aiheuttamina vain niiden liittyessä tyypilliseen oireeseen tai taudin ollessa muuten varmistettu.
Muut oireet. Edellä on käyty läpi vain borrelioosin pääoireet, jotka aiheutuvat sellaisten elinten sairastumisesta, joihin spirokeetta mieluiten pesiytyy. Disseminaatiovaiheen jälkeen borrelia voi aiheuttaa infektion lähes missä elimessä tahansa. Yksittäistapauksina on kuvattu esimerkiksi hepatiitteja, erilaisia silmänsisäisiä ja -ulkoisia infektioita (Winward ym. 1989) sekä orkiitteja (Steere 1989). Borrelia voi myös levitä sikiöön ja johtaa sikiön kuolemaan (Rahn ja Malawista 1991). Lymen alueella tehdyssä tutkimuksessa ei kuitenkaan todettu yhteyttä synnynnäisten epämuodostumien ja napaveren vasta-ainepitoisuuden välillä (Steere 1989).
Borrelioosin diagnostiikka
Borrelioosin diagnoosi on aina perustaltaan kliininen, mutta tueksi tarvitaan laboratoriotutkimuksia. Perusteellinen anamneesi on borrelioosidiagnostiikan kulmakivi. Punkinpuremaa ja EM:ia kannattaa kysyä parinkin vuoden ajalta. Punkinpureman ja EM:n puuttuminen ei kuitenkaan sulje pois borrelioosia. Myös vierailu endeemisellä alueella kuuluu kysyttäviin asioihin. Aluetta voidaan pitää borrelioosin suhteen endeemisenä, jos siellä esiintyy tautia ja tarvittavia vektoreita. Tällä perusteella Ahvenanmaa, saaristo ja eteläinen rannikkoseutu ovat varmasti endeemisiä alueita. Endeemisellä alueella tulee epämääräisiin oireisiin liittyviin positiivisiin laboratoriotuloksiin suhtautua vakavammin kuin muualla.
Epäspesifisistä laboratoriolöydöksistä tyypillisin on seerumin IgM:n pitoisuuden polyklonaalinen suureneminen. Meningoradikuliitille on tyypillistä likvorin lymfosytaarinen pleosytoosi ja suurentunut proteiinipitoisuus. Proteiinipitoisuus suurenee sekä veri-aivoesteen vaurioitumisen että intratekaalisen immunoglobuliinintuotannon takia.
Käytännössä spesifinen diagnoosi perustuu lähes aina serologiaan."
"Suurena pysyvä IgM- tai IgG-vasta-aineiden pitoisuus viittaa pitkittyneeseen infektioon (Craft ym. 1984). "
"Borreliaan tehoavat monet mikrobilääkkeet (Cryan ja Wright 1990). Hoitosuositukset ovat muuttuneet nopeasti ja muuttuvat todennäköisesti vastakin. Suositukset eivät aina perustu laajoihin ja hyvin kontrolloituihin tutkimuksiin, vaan yleensä lääkkeiden tehokkuuteen in vitro (Rahn ja Malawista 1991). "
"EM:n ja muiden varhaisoireiden hoidossa yleensä riittää suun kautta annettava 2-3 viikon mittainen hoito (Rahn ja Malawista 1991). Nykyisin käypä hoito on amoksisilliini annoksin 1 g x 2. Lapsille annos on 50 mg/kg/vrk. Vaihtoehtoina tulevat kysymykseen doksisykliini annoksin 100 mg x 2 ja lapsille erytromysiini annoksin 30 mg/kg/vrk. Erytromysiinin teho tosin on in vivo heikompi kuin in vitro.
Myöhäisoireiden hoidossa käytettiin aiemmin suuriannoksista, lyhytaikaista penisilliinihoitoa laskimoon. Tämä hoito todettiin kuitenkin melko usein tehottomaksi (Dattwyler ym. 1988a). Vaikka pensilliinihoidolla edelleenkin on kannatusta, suositellaan meningiitin ja muiden keskushermostoinfektioiden, kardiitin ja AV- katkosten sekä artriitin hoitoon keftriaksonia annoksin 2 g x 1 laskimoon 2-3 viikon ajan (Rahn ja Malawista 1991). Yhä ilmeisemmäksi on kuitenkin käynyt, että 2-3 viikon kuurit ovat liian lyhyitä borrelian hoidossa, vaikka käytettäisiin hyvinkin tehokkaita lääkkeitä. Nykyinen suositus myöhäisborrelioosin hoitoon on keftriaksonia seuraava vähintään sadan päivän kuuri amoksisilliinia (0.5 g x 3) yhdessä probenesidin (0.5 g x 3) kanssa (Burrascano 1990).
Lihas- ja niveloireiden hoitoon suositellaan mikrobilääkkeitä, vaikka niiden hyödyllisyydestä ei ole kiistatonta näyttöä (Rahn ja Malawista 1991). Nivelen sisäistä kortikosteroidihoitoa tulee yleensä välttää niin kauan kuin borrelioosia ei ole varmasti suljettu pois, koska steroidit voivat heikentää mikrobilääkkeiden tehoa (Rahn ja Malawista 1991). Kortikosteroideja tulee muissakin tiloissa välttää ennen borrelioosin pois sulkua.
Raskaudenaikaisen borrelioosin hoito on melko kiistanalainen asia. Rahn ja Malawista (1991) suosittelevat laskimoon annettavaa keftriaksonia kaikkien raskaudenaikaisten borrelioosien hoitoon. Vain yksittäinen EM voitaisiin hoitaa suun kautta annettavalla amoksisilliinilla. "
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Duodecim 12/2009
Voiko Lymen borrelioosi kroonistua?
Lääketieteellinen Aikakauskirja Duodecim
2009;125(12):1269-76
Peter Wahlberg ja Dag Nyman
Katsaus
English summary: Chronic Lyme Borreliosis - Fact or Fiction?
Infektion luonne
Infektion vaiheet ja oireisto
Pitkittyneet oireet
Infektion kulku solutasolla
Erotusdiagnostiikan ongelmia
Borreliainfektion toteaminen
Pitkittyneen Lymen taudin hoidon tarve ja periaatteet
Lopuksi
Kirjallisuutta
Lymen borrelioosin oireet voivat pitkittyä monella eri tavalla, joskus kroonistuakin. Jatkuva aktiivinen infektio hoidon jälkeen on Suomessa harvinainen ja silloinkin useimmiten antibioottihoidon puuttumisen tai väärän hoidon seuraus. Suurimmat diagnostiset vaikeudet ovat aktiivisen infektion indikaattoreiden puute ja oireiston monisärmäisyys. Oireita esiintyy tavallisimmin hermostosta ja nivelistä. Vaikka monia johtolankoja on löytynyt, ei tiedetä yksityiskohtaisesti, miksi tulehdus joskus jatkuu pitkään onnistuneenkin hoidon jälkeen. Pitkittyneiden oireiden ehkäisyssä tärkeintä on, että diagnoosi tehdään varhain ja antibioottihoito on suositusten mukainen. Tauti muistuttaa muita sairauksia, ja erotusdiagnostiikka on ratkaisevan tärkeää. Ylipitkiä ja toistuvia antibioottihoitoja pitää karttaa.
English summary: Chronic Lyme Borreliosis - Fact or Fiction?
Persistent infection after proper antibiotic treatment in Lyme borreliosis is rare. Symptoms may sometimes continue, especially from the nervous and the articular systems. There are many possible mechanisms for persistence of inflammation even after successful treatment of the infection. The lack of indicators of active infection impedes diagnostics. Early diagnosis and treatment are the most important means for preventing prolonged symptoms and signs. The differential diagnostics are crucial. Repeated treatment with antibiotics is seldom needed, and overlong treatments should be avoided. Lyme borreliosis may sometimes cause permanent tissue damage for which there is no cure.
Käsite krooninen Lymen tauti on kiistanalainen. Muutama vuosi sitten Yhdysvaltojen päivälehdet kertoivat, että Allen Steere - eräs Lymen borrelioosin (LB) löytäjistä - oli saanut tappouhkauksia, koska hän ei ollut hyväksynyt diagnoosia chronic Lyme disease eikä suostunut antamaan potilaiden vaatimaa antibioottihoitoa.
Eräiden tutkijoiden mielestä hoidetun borrelioosin pitkittyneitä muotoja ei ylipäänsä ole olemassa: "hoidettu potilas on terve". Toisten mielestä tarvitaan kuukausia kestäviä antibioottihoitoja aina, kun borrelioosin oireet uusivat tai pitkittyvät. Cairnsin ja Goodwinin (2005) 504 potilaan ja 530 verrokin meta-analyysi osoitti, että jatkuvaa väsymystä, niveloireita, lihaskipua ja neurokognitiivisia häiriöitä esiintyi merkitsevästi enemmän LB-potilailla kuin verrokeilla. Yhdysvalloissa kiista on pelkistynyt kahden koulukunnan väliseksi, ja kannanotot ovat erittäin jyrkät (Cameron ym. 2004, Wormser ym. 2006, Feder ym. 2007, Halperin ym. 2007). Euroopassa asenteet ovat olleet maltillisempia (Brouqui ym. 2004, Societé de pathologie infectieuse 2007, EUCALB 2008).
Epäselvyys johtuu osaksi käsite-eroista: jotkut tutkijat tarkoittavat termillä krooninen LB vain itse infektion jatkumista, toiset taas kaikkia entisenkin LB-potilaan tuntemia oireita (post-Lyme disease). LB on monikirjoinen, ja sen diagnostiikka ja hoito eivät ole kaavamaisia.
Kukaan ei kiistä, että oireita voi esiintyä LB:n jälkeen, vaikka aktiivinen infektio olisi sammunutkin. Nämä oireet aiheuttavat ongelmia sekä potilaalle että lääkärille. Potilas uskoo, että ne merkitsevät infektion jatkumista, ja lääkärin on vaikeaa perustella, miksi antibiootteja ei tarvita.
Infektion luonne
Puutiaisvälitteinen spirokeettatauti LB on monimuotoinen, monen elinsysteemin tartuntatauti, jonka aiheuttavat Borrelia burgdorferin (Bb) useat eri lajit ja lajien kymmenet variantit. Yhdysvalloissa aiheuttaja on melkein yksinomaan Bb sensu stricto, mutta Suomessa kuten muuallakin Euroopassa B. afzelii ja B. garinii ovat tavallisimmat. Alalajien aiheuttamat kliiniset taudinkuvat eivät ole täysin samanlaisia, ja tämän johdosta Yhdysvaltojen diagnostiikkaa ja hoitoperiaatteita ei voida aina soveltaa Euroopan oloihin.
Oireiden vaihtelevaisuus on LB:n tunnusmerkki. Ensivaiheen erythema migrans on luonteenomainen oire, mutta muuten tauti ansaitsee toiselta spirokeettataudilta syfilikseltä perimänsä lisänimen "suuri matkija". Syy tähän on, että LB:n oireet syntyvät harvoin itse infektiosta; useimmiten ne aiheutuvat niistä reaktioista, joiden avulla elimistö yrittää suojautua.
Taudin maantieteellisesti vaihteleva esiintyvyys vaikeuttaa diagnostiikkaa. Seuduilla, joilla borrelia on endeeminen - esimerkiksi Lounais-Suomessa ja Ahvenanmaalla - terveiltäkin asukkailta usein löytyy serologinen tausta eli subkliinisen tai diagnosoimattoman parantuneen infektion serologisia jälkiä. Yksinkertaista ja varmaa rutiinimenetelmää LB-infektion aktiivisuuden osoittamiseksi ei vieläkään ole saatavissa.
Infektion vaiheet ja oireisto
Jos infektio pääsee disseminoitumaan ihosta muualle elimistöön, se voi aiheuttaa hoitamattomana pitkäaikaisia oireita ainakin hermostosta ja nivelistä. Nämä oireet saattavat jatkua vuosikausia ja aiheuttaa jopa pysyvän työkyvyttömyyden.
Tauti ei aina etene kaikkien vaiheiden läpi vaan voi myös ilmaantua suoraan myöhempien vaiheiden oirein.
Kuva 1. Lymen borrelioosin vaiheet.
Erythema migrans (EM), Bb-infektion tavallisin primaarivaihe, on helppohoitoinen, ja sillä on hyvä ennuste. Jo tässä vaiheessa voi kuitenkin esiintyä disseminaatiota keskushermostoon (Oksi ym. 2001). Hoidon jälkeenkin borrelian DNA:ta saattaa löytyä ihosta jopa kuukausien ajan, ja noin 1 %:ssa tapauksista borreliaspirokeettoja on viljeltävissä eryteema-alueen ihobiopsianäytteistä. Neuroborrelioosia muistuttavia oireita esiintyy 5-20 %:lla antibiooteilla hoitamattomista EM-potilaista yli kuuden kuukauden kuluttua tartunnasta.
Neuroborrelioosi. Valtaosa aikaisista neuroborreliooseista paranee itsestään. Noin kolmanneksella infektio kuitenkin jatkuu hoitamattomana, aiheuttaen myöhäisvaiheen muutoksia. Hyvissä ajoin hoidetun varhaisen neuroborrelioosin oireet rauhoittuvat yleensä nopeasti, ja kokemuksemme mukaan ne tavallisesti häviävät kokonaan parissa viikossa ja infektio paranee. Ljøstadin ja Henriksenin (2008) mukaan pysyvistä oireista (väsymys, keskittymisvaikeudet, kivut) on tosin ilmoitettu jopa 25-50 %:lla potilaista viiden vuoden kuluttua. Suuri määrä johtunee hoitokäytännöstä, ja Suomen oloissa tulokset ovat selvästi paremmat. Toisessa Berglundin ym. (2002) aineistossa arkitoimia haittavia oireita esiintyi 12 %:lla potilaista jopa viisi vuotta hoidon jälkeen.
Sopivan antibioottihoidon jälkeen likvorin solumäärä pienenee muutamassa viikossa. Keskushermoston neuroborrelioosissa intratekaalinen vasta-ainemuodostus voi jatkua kuukausia tai vuosia, vaikka infektio on hoidettu hyvällä tuloksella.
Nivelborrelioosi. Borreliainfektiolle on luonteenomaista, että ilman hoitoa syntyy joidenkin kuukausien kuluttua niveltulehduksia - Yhdysvalloissa noin 60 %:lle potilaista (Steere ym. 1987) ja Euroopassa 15-25 %:lle (Priem ym. 2003, EUCALB 2008). Antibioottihoito useimmiten parantaa ne.
Pitkittyneet oireet
Pitkittyneiden oireiden syyt ovat vain osaksi tunnettuja. Kyseessä voi olla esimerkiksi jatkuva infektio, pysyvä elinvaurio, immuuni-ilmiö tai sytokiininmuodostus. Diagnoosin kannalta on muistettava, että vasta-aineita löytyy usein terveiden LB:tä sairastaneiden seerumista jopa vuosikausia onnistuneenkin hoidon jälkeen (Peltomaa ym. 2003). Sekä potilaalla että spirokeetalla voi olla ominaisuuksia, jotka edistävät oireiden ja paranemattomien kudosvaurioiden syntymistä (Nardelli ym 2008). Ei saa myöskään unohtaa, että tällekin bakteerille voi kehittyä resistenssiä tiettyjä antibiootteja kohtaan (Hunfeld ja Brade 2006).
Kuva 2. Miksi Lymen tauti voi pitkittyä?
Pitkittynyt infektio. Jatkuva spirokeettainfektio asianmukaisen hoidon jälkeen on pitkäaikaisten borreliaoireiden harvinainen syy. LB:n myöhempien vaiheiden suomalaisessa hoitotutkimuksessa (Oksi ym. 2007) hoito todettiin epäonnistuneeksi vuoden kuluttua vain alle 2 %:lla potilaista. Persistoivaa infektiota pidetään kuitenkin edelleen eräänä mahdollisena syynä borreliainfektion jälkeisen krooniseen tulehdukseen.
Spirokeetalla on monta keinoa elimistön puolustusmekanismien välttämiseksi (Alitalo 2004). Esimerkkejä ovat mm. antigeeninvaihto, komplementtisysteemin välittämän bakteeri-inaktivaation estäminen ja elimistön proteaasien käyttö avaimena kudokseen pääsemiseksi. Spirokeetta voi välttää tai vähentää antibioottien vaikutusta piiloutumalla kudoksiin (esim. jänteisiin) ja soluihin, joihin antibiootit tunkeutuvat huonosti. On myös esitetty hypoteesi, että se voisi muuttua heikosti aktiiviseksi ja antibiootteja sietäväksi, mm. kystiseksi muodoksi, mutta riittävää dokumentaatiota ei ole esitetty.
Sekä eri Bb-lajeilla että eri potilailla voi olla ominaisuuksia, jotka edistävät infektion leviämistä ja pitkittymistä. RST1-ryhmään kuuluva Bb (rRNA gene spacer restriction fragment length polymorphism genotype) on erittäin virulentti, aikaansaa erityisen rajun tulehduksen ja disseminoituu kudoksiin helpommin kuin muiden RST-ryhmien borreliat. Tämä voi edistää infektion jatkumista.
Borrelian pintalipoproteiineja sitoutuu Tollin kaltaisten reseptorien kompleksiin (TLR) 1/2, ja ne käynnistävät Th1-solureaktion. TLR-polymorfismi vaikuttaa borreliainfektion aiheuttamien reaktioiden kirjoon sekä eläimillä että ihmisillä.
Pitkittyneet neuroborrelioosioireet. Borrelia aktivoi mikrogliaa, joka muodostaa merkkiaineita, kuten interleukiini 6:ta, tuumorinekroositekijä alfaa ja prostaglandiini E2:ta sekä lisää TLR:n ja lipopolysakkaridia sitovan makrofagireseptorin CD14:n ilmentymistä (Rasley ym. 2002). Infektion aikaansaamat perivaskulaariset tiivistymät voivat häiritä paikallista verenkiertoa. Ristireaktioita borreliavasta-aineiden ja hermokudoksen välillä esiintyy, samoin adaptiivista vastetta suoraan hermokudosta kohtaan ilman ristireaktiota.
Jatkuva niveltulehdus. Persistoiva antibiootteihin reagoimaton artriitti on Euroopassa harvinainen oire. Yhdysvalloissa sitä vastoin se syntyy noin 10 %:lle. Niveltulehdus jatkuu samassa nivelessä kuukausia, vuosiakin. Usein on kyseessä ison nivelen - esimerkiksi polvinivelen - monoartriitti.
Luonteenomaisia löydöksiä ovat synoviakudoksen paksuuntuminen ja makrofagi- ja T-soluinfiltraatio (pääasiassa CD4+ Th1-soluja ja myös CD20+B-soluja). Nivelessä on nestettä, joka sisältää runsaasti soluja, varsinkin liuskatumaisia neutrofiileja. Borreliaviljely- ja PCR-löydös ovat negatiiviset, mutta veressä esiintyy borrelian pintaproteiinin OspA:n vasta-aineita. Endoskooppinen synovektomia voi olla tuloksekas hoitokeino (Steere ym. 2006, Steere ja Angelis 2006).
Autoimmuuni-ilmiöitä on laajalti etsitty pitkittyneen niveltulehduksen mekanismeiksi (Steere ym. 2006). Yhdysvalloissa suoritettujen OspA-antigeenirokotusten komplikaationa ilmeni joillakin rokotetuilla niveltulehduksia. Valtaosalla oli HLA-DRB1*0401-alleeli. Kyseessä on voinut olla samankaltaisuus (molecular mimicry) borrelian OspA:n aminohapposekvenssin 165-175 ja miltei identtisen sekvenssin ihmisen LFA-1-antigeenin välillä. Tällä OspA-sekvenssillä on voimakas affiniteetti HLADRB1*0401-molekyyliin. Kyseinen ilmiö ei ainakaan yksinomaan ole borrelian hoidon jälkeisen tulehduksen laukaisija. Se koskenee vain borrelialajia Bb sensu stricto, eikä sitä siis voida soveltaa laajemmalti eurooppalaisiin potilaisiin. Täällä B. afzelii ja garinii dominoivat ja kuitenkin esiintyy - joskin harvemmin kuin Yhdysvalloissa - potilaita, joilla on antibiootteihin reagoimaton niveltulehdus.
Antibioottiherkässä Bb sensu stricto -infektiossa OspA-spesifisten T-solujen lukumäärä nivelessä on ennen hoitoa suuri ja pienee hoidon jälkeen, vaikka resistentti tulehdus kehittyisikin, joten nämä solut tuskin ovat ratkaisevia tekijöitä kroonisen tulehduksen syntymässä (Kannian ym. 2007).
Toiseksi jatkuvan niveltulehduksen syyksi on esitetty, että pieni määrä spirokeetta-antigeenia nivelpussissa voisi ylläpitää tulehdusprosessia. Vaihtoehtoisesti tällainen mikroinfektio voisi laukaista autoimmuunivasteen, mikä tapahtuisi edellä mainitun molekyylien samankaltaisuuden tai T-solujen aktivoinnin kautta. Nivelnesteestä ja nivelpussista tehty PCR-tutkimus antaa kuitenkin melkein aina negatiivisen tuloksen, eikä borreliaviljelykään niistä onnistu. Kun sitä paitsi vasta-ainepitoisuudet pienenevät merkitsevästi antibioottihoidon jälkeen mutta niveltulehdus kuitenkin jatkuu, tämä mikroinfektioilmiö on epätodennäköinen tulehduksen syy (Drouin ym. 2008).
Infektion kulku solutasolla
Lukuisat hiirillä tehdyt kokeet valottavat Bb-infektion kulkua. Bakteerin viesti kulkee solun sisälle adaptorin MyD88 kautta. Tämän adaptorin puute vaikuttaa infektion sytokiinivasteeseen, jolloin infektio leviää tavallista helpommin. Kun adaptori puuttuu, antigeenispesifistä Th1-vastetta ei synny (Bockenstedt ym. 2006). Tästä seuraa, että Th2-soluvaste Bb-infektioon on tällöin vastaavasti vahvempi ja pitkäaikainen ja antibiooteille resistentti infektio voi kehittyä.
Reseptori CD28:n puuttuessa kehittyy usein krooninen niveltulehdus Bb-infektion jälkeen, ja samalla muodostuu OspA:n vasta-aineita (Iliopoulou ym. 2008). Siirtogeenisillä hiirillä yhdistelmä CD28 -/- ja HLA-DR4 +/+ aiheuttaa aina pysyvän niveltulehduksen. Voimakasta Th1-vastetta ja sitä seuraavaa heikohkoa Th2-vastetta on esitetty paranemisen ehdoksi ihmisillä (Jarefors ym. 2007).
Kuva 3. T-solujen aktivaatio. Ensin Th1-immunireaktiot stimuloituvat, ja sen jälkeen tapahtuu niiden vaimennussäätely (down-regulation) ja Th2-vaste syntyy. A) Kostimulaation kautta tavanomaisen MHC + antigeeni + T-solureseptori (TSR-) kompleksin lisäksi antigeenia esittelevän solun (APC) ligandi B7 reagoi T-solun kostimulaattorin CD28-molekyylin kanssa. T-solu proliferoituu ja erilaistuu. Th1-reaktio tuottaa sytokiineja kuten gammainterferonia ja interleukiini 2. B) B7 reagoi myöhemmin reseptorin CTLA-4 kanssa (cytotoxic Tlymphocyte associated antigen 4), jolloin tapahtuu vaimennussäätely ja Th1-solun inaktivaatio. MHC = major histocompability complex.
Tartutettaessa C3H/He-hiiriä Bb sensu strictolla ja B. gariniilla syntyy levinnyt infektio pitkäaikaisine niveloireineen. Antibioottihoidon jälkeen spirokeettoja ei enää voida PCR:llä eikä viljelyllä osoittaa mutta oireet jatkuvat edelleen. Anti-TNF:n annon jälkeen voidaan kuitenkin taas viljelemällä todeta spirokeettoja koe-eläimissä (Yrjänäinen ym. 2007).
Kysymys, miksi borreliainfektion käynnistämä tulehdus voi jatkua pitkän aikaa hoidon jälkeen, on siis edelleen yksityiskohdiltaan vastausta vailla. Ilmiö riippuu monista elimistön puolustusmekanismeista, kuten TLR-polymorfismista, soluaktivaatiosta ja HLADRB1-alleleista (Iliopoulou ym. 2008).
Erotusdiagnostiikan ongelmia
On mahdotonta luetella kaikkia LB:n erotusdiagnostisia kompastuskiviä. Esimerkiksi nopean dementoitumisen on todettu voivan johtua LB:sta ja parantua täysin antibioottihoidon avulla. Toisaalta esimerkiksi perifeerisille halvauksille saattaa olla Bb-positiivisella potilaalla muitakin syitä kuin LB. Niveltulehdus voi myös johtua muusta kuin LB:stä vaikka Bb-seroreaktio olisikin positiivinen. Nivelreuman monet esiintymismuodot sekä muun muassa reaktiivinen artriitti, on otettava huomioon.
Borreliainfektion toteaminen
Aktiivisen Bb-infektion varmaa objektiivista indikaattoria ei ole lukuun ottamatta spirokeetan viljelyä. Pitkittyneiden oireiden diagnostiikassa lähtökohtana ovat aina kliiniset oireet ja löydökset ja tämän jälkeen seuraavat samat serologiset tutkimukset kuin muutenkin LB:ssä (EUCALB 2008, Wahlberg ja Nyman 2008), perustana VlsE C6 -vasta-aineanalyysi ja Western blot -varmistus. LB-diagnostiikassa hoitavan lääkärin ei yleensäkään pitäisi koskaan tyytyä mitäänsanomattomaan laboratoriovastaukseen "Borrelia plus" vaan laboratorion tulee antaa selkeä ja kantaa ottava lausunto, joka suhteutetaan aikaisempiin löydöksiin. Jos oireet ja serologinen tulos sopivat aktiiviseen infektioon, harkitaan lisävarmistusta esimerkiksi laajentamalla Western blot -nauhakirjoa. Positiivinen PCR-löydös on käyttökelpoinen varmistus. Viljely olisi vielä parempi mutta edelleen kliinisen todellisuuden ulottumattomissa.
Erotusdiagnostiikalla on keskeinen merkitys. Esimerkiksi aivojen tietokonetomografian tai magneettitutkimuksen laiminlyöminen voi olla kohtalokasta, jos potilaalla on keskushermoston oireita, jotka voivat viitata muuhun sairauteen LB:n sijasta tai sen lisäksi.
Pitkittyneen Lymen taudin hoidon tarve ja periaatteet
Yhdysvaltalaisessa hoitokokeilussa (Klempner ym. 2001) annettiin antibioottia tai lumelääkettä valikoimattomille erilaisia psykologisia ja neurologisia oireita poteville, sekä seronegatiivisille että seropositiivisille, jotka olivat aikaisemmin saaneet "suositeltuja" antibioottikuureja LB:n takia. Kliiniseen diagnoosiin ei pyritty, joten kokeilun suoritus eroaa huomattavasti nykyisistä hoitoperiaatteista. Antibiootti- ja lumeryhmien tulosten välillä ei ollut eroja. Myöhemminkin on raportoitu tuloksettomista yrityksistä hoitaa LB:n jälkeisiä väsymystiloja antibiooteilla.
Asianmukaisesti jo hoidettujen potilaiden pitkittyneitä LB:n oireita ei pidä refleksimäisesti hoitaa uudestaan antibiooteilla, vaan aktiivinen infektio on aina pyrittävä varmistamaan parhaalla käytettävissä olevalla tavalla. Jos toisaalta potilaan aikaisemmin saama antibioottihoito ei ole ollut ohjeiden mukainen, annetaan herkemmin säännönmukainen hoito kuten uudessa infektiossa.
Jos potilas on huolissaan infektion jatkumisesta ja aktiivinen infektio ei ole pois suljettavissa, voidaan harkita toisen antibioottihoidon antamista. Potilaalle on kerrottava, että kyseessä on hoitokokeilu, jota ei toisteta.
Tarinanluonteisten potilaskokemusten mukaisia ylipitkiä antibioottihoitojaksoja (jopa yli 6 kuukautta) ei suositella jo ennestään asianmukaisesti hoidetuille potilaille.
Kuva 4. Lymen borrelioosin pitkittyneiden oireiden käsittelyn vaihtoehtoja. Bb = Borrelia burgdorferi.
Lopuksi
Vastaus tämän katsauksen otsikon kysymykseen on myönteinen: Lymen borrelioosi (tai oikeammin Lymen tauti) voi kroonistua, tosin vain harvoin varsinaisena spirokeettainfektiona.
Hoidotta jäämisen tai hoidon vajavaisuuden vuoksi jatkuva infektio on varteenotettava mahdollisuus. Tällöin disseminoitunut aktiivinen borreliaspirokeettainfektio aiheuttaa pitkäaikaisia oireita varsinkin hermostosta ja nivelistä. Ne voivat jatkua vuosikausia aiheuttaen jopa pysyvän työkyvyttömyyden.
Asianmukaisen hoidon jälkeisten oireiden syynä aktiivinen infektio on harvinainen. Kroonisen infektion tärkeimmäksi syyksi nousee siis LB:n diagnoosin ja hoidon laiminlyöminen tai myöhästyminen. Uuden borreliainfektion mahdollisuutta ei pidä myöskään unohtaa!
Vaikka hoidetun LB:n myöhäisiä oireita laajalti liioitellaankin, on tosiasia, että LB voi aiheuttaa vuosikausia jatkuvia vaivoja. Useimmin oireilla on jokin muu syy kuin jatkuva infektio. LB:n käynnistämien oireiden patogeneesi vaihtelee; immunologiset mekanismit ja pysyvä elinvaurio ovat tavallisimmat.
LB:n diagnoosin ja hoidon viivästyminen viikoilla tai kuukausilla huonontaa ennustetta ja lisää pysyvien elinvaurioiden riskiä. Toisaalta on vältettävä hätiköityä antibioottihoitoa ilman mahdollisimman varmaa diagnoosia. Antibiooteilla hoidetaan vain infektioita!
LB voi muistuttaa monia muita sairauksia, ja monet muut sairaudet voivat tämän takia muistuttaa LB:ta, eli yli- ja alidiagnostiikan vaara on ilmeinen. Endemia-alueilla yleisesti esiintyvät myönteiset Bb-seroreaktiot saattavat viedä hakoteille. On ensiarvoisen tärkeää pohtia tarkoin erotusdiagnostiikkaa. Tämän laiminlyöminen voi käydä kohtalokkaaksi.
LB on monessa osassa Suomea kansantauti, joka aiheuttaa runsaasti pitkäaikaistakin työkyvyttömyyttä. Sitä on esiintynyt Suomessa yli 100 vuoden ajan. Ei voi olla pohtimatta, kuinka paljon tämä tauti ennen sen syyn löytämistä on mahtanut vaikuttaa kansan terveyteen ja sairastavuuteen. Tämä on jokaiselle lääkärille aprikoinnin - ja nöyryyden - aihe.
PETER WAHLBERG, LKT, professori
Åsvägen 14-B
22100 Mariehamn
DAG NYMAN, LT, professori
Tingebergsvägen 31
22150 Jomala
Kirjallisuutta
Alitalo A. Complement evasion by borrelia burgdorferi spirochetes. Väitöskirja, Helsingin yliopisto 2004.
Berglund J, Stjernberg L, Ornstein Tykesson-Joelsson K, Hallstein W. 5-y follow-up study of patients with neuroborreliosis. Scand J Infect Dis 2002;34:421-5.
Bockenstedt LK, Liu N, Schwartz J, Fish D. MyD88 deficiency enhances acquisition and transmission of borrelia burgdorferi by Ixodes scapularis ticks. Infect Immun 2006;74:2154-60.
Brouqui P, Bacellar F, Baranton G, ym. Guidelines for the diagnosis of tick-borne bacterial diseases in Europe. Clin Microbiol Infect 2004;10:1108-32.
Cairns V, Goodwin J. Post-Lyme borreliosis syndrome: a meta-analysis of reported syndromes. Int J Epidemiol 2005;34:1340-5.
Cameron D, Gaito A, Harris N, ym. Evidence-based guidelines for the management of Lyme disease. The International Lyme and Associated Diseases Society. Expert Rev Anti Infect Ther 2004;2 Suppl:1-13.
Drouin EE, Glickstein L, Kwok WW, Nepom GT, Steere AC. Human homologues of a Borrelia T cell epitope associated with antibiotic-refractory Lyme arthritis. Mol Immunol 2008;45:180-9.
EUCALB (European Union Concerted Action on Lyme Borreliosis) 2008. http://meduni09.edis.at/eucalb/cms/index.php?lang=en
Feder HM, Johnson BJB, Connell S, Shapiro ED. Steere AC, Wormser GP. A Critical appraisal of "Chronic Lyme Disease". N Engl J Med 2007;357:1422-30.
Halperin JJ, Shapiro ED, Logigian E, ym. Practice Parameter: Treatment of nervous system Lyme disease (an evidence-based review). Neurology 2007;69:91-102.
Hunfeld KP, Brade V. Antimicrobial susceptibility of Borrelia burgdorferi sensu lato: what we know, what we don't know, and what we need to know. Wien Klin Wochenschr 2006;118:659-68.
Hytönen J, Hartiala P, Oksi J, Viljanen MK. Borreliosis: recent research, diagnosis and management. Scand J Rheumatol 2008;37:161-72.
Iliopoulou BP, Alroy J, Huber BT. Persistent arthritis in Borrelia burgdorferi-infected HLA-DR4-positive CD28-negative mice post-antibiotic treatment. Arthritis Rheum 2008;58:3892-901.
Jarefors S, Janefjord CK, Forsberg P, Jernmalm MC, Ekerfelt C. Decreased up-regulation of the interleukin-12Rb2-chain and interferon-gamma secretion and increased number of forkhead box P3-expressing cells in patients with a history of chronic Lyme borreliosis compared with asymptomatic Borrelia-exposed individuals. Clin Exp Immunol 2007;147:18-27.
Kannian P, Drouin E, Glickstein L, Kwok WW, Nepom GT, Steere AC. Decline in frequencies of Borrelia burgdorferi OspA161-175 specific T cells after antibiotic therapy in HLA-DRB1*0401-positive patients with antibiotic-responsive or antibiotic refractory Lyme arthritis. J Immunol 2007;179:6336-42.
Klempner MS, Linden T, Evans J, ym. Two control trials of antibiotic treatment in patients with persistent symptoms and a history of Lyme disease. N Engl J Med 2001;345:85-92.
Ljøstad U, Henriksen TH. Management of neuroborreliosis in European adult patients. Act Neurol Scand 2008;117:22-8.
Nardelli DT, Callister SM, Schell RF. Lyme arthritis, current concepts and a change in paradigm. Clin Vaccine Immunol 2008;15:21-34.
Oksi J, Marttila H, Soini H, Aho H, Uksila J, Viljanen MK. Early dissemination of Borrelia burgdorferi without generalized symptoms in patients with erythema migrans. APMIS 2001;109:581-8.
Oksi J, Nikoskelainen J, Hiekkanen H, ym. Duration of antibiotic treatment in disseminated Lyme borreliosis: a double-blind, randomized, placebo-controlled, multicenter clinical study. Eur J Clin Microbiol Infect Dis 2007;26:571-81.
Peltomaa M, McHugh G, Steere AC. Persistense of the antibody response to the VlsE sixth invariant region (IR6)peptide) of Borrelia burgdorferi after succesful treatment of Lyme disease. J Infect Dis 2003;187:1178-86.
Priem S, Munkelt K, Franz JK, ym. Epidemiologie und Therapie det Lyme-Arthritis und anderer Manifestationen der Lyme-Borreliose in Deutschland. Z Rheumatol 2003;62:450-8.
Rasley A, Anguita J, Marriott I. Borrelia burgdorferi induces inflammatory mediator production by murine microglia. J Neuroimmunol 2002;130:22-31.
Sharpe AH, Abbas AK. T-cell costimulation - biology, therapeutic potential and challenges. N Engl J Med 2006;355:973-5.
Societé de pathologie infectieuse de langue Française. Borréliose de Lyme: démarches diagnostiques, thérapeutiques et préventives. Medecine et maladies infectieuses 2007;37 Suppl 3:153-74.
Steere AC, Angelis SM. Therapy for Lyme arthritis: strategies for the treatment of antibiotic-refractory arthritis. Arthritis Rheum 2006;54:3079-86.
Steere AC, Klitz W, Drouin EE, ym. Antibiotic-refractory Lyme arthritis is associated with HLA-DR molecules that bind a Borrelia burgdorferi peptide. J Exp Med 2006; 203:961-71.
Steere AC, Schoen RT, Taylor E. Lyme arthritis. Ann Intern med 1987;107:725-31.
Wahlberg P, Nyman D. Lymen borrelioosi. Kirjassa: Kunnamo I, toim. Lääkärin käsikirja 2008. Helsinki: Kustannus Oy Duodecim 2008, s. 17-20.
Wormser GP, Dattwyler RJ, Shapiro ED, ym. The clinical assessment, treatment and prevention of Lyme disease, human granulocytic anaplasmosis, and babesiosis: Clinical practical puidelines by the Infectious Diseases Society of America. Clin Infect Dis 2006;43:1089-134.
Yrjänäinen H, Hytönen J, Song XR, Oksi J, Hartiala K, Viljanen MK. Anti tumor-necrosis factor-alpha treatment activates Borrelia burgdorferi spirochetes 4 weeks after ceftriaxone treatment in C3H/He mice. J Infect Dis 2007;195:1489.
Borreliabakteeri muuntuu stressin esim. antibioottien vaikutuksesta vaikeasti hoidettavaan L-muotoon. (Johns Hopkins 2009)
The article below (by Steve Nery) was published in at least three Maryland newspapers last week- the Star Democrat (front page), the Kent County News and the Record Observer.
The Kent County News
Lyme disease victims eye beneficial study.
By Steve Nery
BALTIMORE Lyme disease patient advocates are hopeful that new studies on especially resistant forms of bacteria at Johns Hopkins could help lead to less restrictive treatment guidelines.
The November issue of the Johns Hopkins newsletter contains an article about research at the Bloomberg School of Public Health on bacteria that can morph into the "L-form" bacteria that lack cell walls that are resistant to antibiotics. They include Borrelia burgdorferi, the bacteria that causes Lyme disease, as well as the bacteria responsible for anthrax, syphilis, tuberculosis, food poisoning and stomach ulcers.
The Infectious Diseases Society of America recommends the use of an antibiotic for a maximum of four weeks to treat Lyme disease, but many patients, especially those not diagnosed swiftly following a tick bite, report effects that can continue to linger for life. Droves of Lyme disease patients spend thousands in out-of-pocket dollars to receive treatment from the few doctors that don't follow the IDSA guidelines.
Ying Zhang, Yanking Yang and William A. Glover authored a study published last month in PloS ONE. The researchers used modern molecular tools to learn more about the origin and biological functions of the L-form bacteria. Researchers have known about the existence of this form of bacteria since the 1930's, but little beyond that.
Zhang, a professor of molecular microbiology and immunology at Bloomberg and the senior author of the study, said in the newsletter that the bacteria take on the L form in response to stress caused by antibiotics. The wall-less cells cluster together in the shape of a fried egg, which makes them ever more resistant to antibiotics.
The team successfully cultured E. coli L-form bacteria and discovered genes that were linked with the inability to grow in the L-form.
These L-forms of various bacteria may be the underlying reason for chronic diseases such as rheumatoid arthritis, according to the newsletter.
"It is possible, with our discovery of the L-form genes, to develop new antibiotics and more effective ones that can be used with current ones as well as new vaccines to ? allow these forms to be eliminated by the immune system", Zhang said in the publication.
Patients with chronic Lyme disease hope new research will change the Infectious Diseases Society of America's Lyme disease treatment guidelines, which are under review as ordered by Connecticut Attorney General Richard Blumenthal.
"Hopkins proving L-form bacteria is not killed by antibiotics while in this form shows that the chronic and debilitating symptoms, disability and death can all be related to ongoing infection in those that have been exposed", said Lucy Barnes, director of the Lyme Disease Education and Support Groups of Maryland
The article below (by Steve Nery) was published in at least three Maryland newspapers last week- the Star Democrat (front page), the Kent County News and the Record Observer.
The Kent County News
Lyme disease victims eye beneficial study.
By Steve Nery
BALTIMORE Lyme disease patient advocates are hopeful that new studies on especially resistant forms of bacteria at Johns Hopkins could help lead to less restrictive treatment guidelines.
The November issue of the Johns Hopkins newsletter contains an article about research at the Bloomberg School of Public Health on bacteria that can morph into the "L-form" bacteria that lack cell walls that are resistant to antibiotics. They include Borrelia burgdorferi, the bacteria that causes Lyme disease, as well as the bacteria responsible for anthrax, syphilis, tuberculosis, food poisoning and stomach ulcers.
The Infectious Diseases Society of America recommends the use of an antibiotic for a maximum of four weeks to treat Lyme disease, but many patients, especially those not diagnosed swiftly following a tick bite, report effects that can continue to linger for life. Droves of Lyme disease patients spend thousands in out-of-pocket dollars to receive treatment from the few doctors that don't follow the IDSA guidelines.
Ying Zhang, Yanking Yang and William A. Glover authored a study published last month in PloS ONE. The researchers used modern molecular tools to learn more about the origin and biological functions of the L-form bacteria. Researchers have known about the existence of this form of bacteria since the 1930's, but little beyond that.
Zhang, a professor of molecular microbiology and immunology at Bloomberg and the senior author of the study, said in the newsletter that the bacteria take on the L form in response to stress caused by antibiotics. The wall-less cells cluster together in the shape of a fried egg, which makes them ever more resistant to antibiotics.
The team successfully cultured E. coli L-form bacteria and discovered genes that were linked with the inability to grow in the L-form.
These L-forms of various bacteria may be the underlying reason for chronic diseases such as rheumatoid arthritis, according to the newsletter.
"It is possible, with our discovery of the L-form genes, to develop new antibiotics and more effective ones that can be used with current ones as well as new vaccines to ? allow these forms to be eliminated by the immune system", Zhang said in the publication.
Patients with chronic Lyme disease hope new research will change the Infectious Diseases Society of America's Lyme disease treatment guidelines, which are under review as ordered by Connecticut Attorney General Richard Blumenthal.
"Hopkins proving L-form bacteria is not killed by antibiotics while in this form shows that the chronic and debilitating symptoms, disability and death can all be related to ongoing infection in those that have been exposed", said Lucy Barnes, director of the Lyme Disease Education and Support Groups of Maryland
Sekä kupan aiheuttaja että borreliabakteeri voivat aiheuttaa etenevän infektion keskushermostossa. Sen seurauksena voi syntyä pysyviä keskushermostovaurioita. Siksi taudin varhaiseen diagnostiikkaan ja hoitoon on kiinnitettäv erityistä huomiota.
Neurol Clin. 2010 Feb;28(1):277-291.
A Tale of Two Spirochetes: Lyme Disease and Syphilis.
Halperin JJ.
Department of Neurology, Madison Avenue, Mount Sinai School of Medicine, NY, USA; Department of Neurosciences, Overlook Hospital, 99 Beauvoir Avenue, Summit, NJ 07902, USA.
Only two spirochetal infections are known to cause nervous system infection and damage: neurosyphilis and neuroborreliosis (nervous system Lyme disease).
Diagnosis of both generally relies on indirect tools, primarily assessment of the host immune response to the organism. Reliance on these indirect measures poses some challenges, particularly as they are imperfect measures of treatment response. Despite this, both infections are known to be readily curable with straightforward antimicrobial regimens. The challenge is that, untreated, both infections can cause progressive nervous system damage. Although this can be microbiologically cured, the threat of permanent resultant neurologic damage, often severe in neurosyphilis and usually less so in neuroborreliosis, leads to considerable concern and emphasizes the need for prevention or early and accurate diagnosis and treatment.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 19932386 [PubMed - as supplied by publisher]
Neurol Clin. 2010 Feb;28(1):277-291.
A Tale of Two Spirochetes: Lyme Disease and Syphilis.
Halperin JJ.
Department of Neurology, Madison Avenue, Mount Sinai School of Medicine, NY, USA; Department of Neurosciences, Overlook Hospital, 99 Beauvoir Avenue, Summit, NJ 07902, USA.
Only two spirochetal infections are known to cause nervous system infection and damage: neurosyphilis and neuroborreliosis (nervous system Lyme disease).
Diagnosis of both generally relies on indirect tools, primarily assessment of the host immune response to the organism. Reliance on these indirect measures poses some challenges, particularly as they are imperfect measures of treatment response. Despite this, both infections are known to be readily curable with straightforward antimicrobial regimens. The challenge is that, untreated, both infections can cause progressive nervous system damage. Although this can be microbiologically cured, the threat of permanent resultant neurologic damage, often severe in neurosyphilis and usually less so in neuroborreliosis, leads to considerable concern and emphasizes the need for prevention or early and accurate diagnosis and treatment.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 19932386 [PubMed - as supplied by publisher]
Norja 2009. 85 neuroborrelioosiin sairastunutta sai hoidoksi joko suun kautta doksisykliiniä tai suonensisäisesti keftriaksonia. Vuoden seuranta-ajan jälkeen noin puolella potilaista oli edelleen objektiivisia ja/tai subjektiivisia oireita. Käytetyllä antibiootilla ei ollut merkitystä hoidon tulokseen.
Remaining complaints 1 year after treatment for acute Lyme neuroborreliosis; frequency, pattern and risk factors
European Journal of Neurology
Volume 17 Issue 1, Pages 118 - 123
U. Ljøstad, Å. Mygland
ABSTRACT
Background and purpose: To chart remaining complaints 1 year after treatment for neuroborreliosis, and to identify risk factors for a non-favorable outcome.
Methods: We followed patients treated for neuroborreliosis prospectively, and assessed outcome by a composite clinical score. The impact on outcome of clinical, demographic and laboratory factors were analyzed by univariate analyses and logistic regression.
Results: Out of 85 patients 41 (48%) had remaining complaints; 14 had objective findings and 27 subjective symptoms. Remaining complaints were associated with pre-treatment symptom duration ≥6 weeks (OR = 4.062, P = 0.044), high pre-treatment cerebrospinal fluid (CSF) cell count (OR = 1.005, P = 0.001), and female gender (OR = 3.218, P = 0.025). Presence of CSF oligoclonal bands (OCBs) was not analyzed in the logistic regression model due to many missing observations, but was found to be more frequent both pre-treatment (P = 0.004) and after 12 months (P = 0.015) among patients with remaining complaints as compared to patients with complete recovery. Further evaluation showed that objective remaining findings, and not subjective symptoms, were associated with pre-treatment symptom duration ≥6 weeks.
No difference in outcome was observed between patients treated with IV ceftriaxone and patients treated with oral doxycycline.
Conclusion: Remaining complaints are common after neuroborreliosis. The majority of the complaints are subjective. Pre-treatment symptom duration ≥6 weeks, high pre-treatment CSF cell count, and female gender seem to be risk factors for remaining complaints. Presence of CSF OCBs may also predict a non-favorable outcome, but this should be further studied. Whether subjective and objective complaints are associated with different risk factors is also an issue for future studies.
Remaining complaints 1 year after treatment for acute Lyme neuroborreliosis; frequency, pattern and risk factors
European Journal of Neurology
Volume 17 Issue 1, Pages 118 - 123
U. Ljøstad, Å. Mygland
ABSTRACT
Background and purpose: To chart remaining complaints 1 year after treatment for neuroborreliosis, and to identify risk factors for a non-favorable outcome.
Methods: We followed patients treated for neuroborreliosis prospectively, and assessed outcome by a composite clinical score. The impact on outcome of clinical, demographic and laboratory factors were analyzed by univariate analyses and logistic regression.
Results: Out of 85 patients 41 (48%) had remaining complaints; 14 had objective findings and 27 subjective symptoms. Remaining complaints were associated with pre-treatment symptom duration ≥6 weeks (OR = 4.062, P = 0.044), high pre-treatment cerebrospinal fluid (CSF) cell count (OR = 1.005, P = 0.001), and female gender (OR = 3.218, P = 0.025). Presence of CSF oligoclonal bands (OCBs) was not analyzed in the logistic regression model due to many missing observations, but was found to be more frequent both pre-treatment (P = 0.004) and after 12 months (P = 0.015) among patients with remaining complaints as compared to patients with complete recovery. Further evaluation showed that objective remaining findings, and not subjective symptoms, were associated with pre-treatment symptom duration ≥6 weeks.
No difference in outcome was observed between patients treated with IV ceftriaxone and patients treated with oral doxycycline.
Conclusion: Remaining complaints are common after neuroborreliosis. The majority of the complaints are subjective. Pre-treatment symptom duration ≥6 weeks, high pre-treatment CSF cell count, and female gender seem to be risk factors for remaining complaints. Presence of CSF OCBs may also predict a non-favorable outcome, but this should be further studied. Whether subjective and objective complaints are associated with different risk factors is also an issue for future studies.
2009. Ruotsalaiset tutkivat vuosina 2000 - 2005 neuroborrelioosiin sairastuneiden potilaspapereita. Tutkimusryhmään valittiin vain sellaiset tapaukset joissa diagnoosiin oli päädytty selkäydinnestenäytteen perusteella. Lasten tavallisin oire oli kasvohermohalvaus, päänsärky ja kuume. Vanhemmilla esiintyi lihas- ja nivelkipuja. Yli kuusi kuukautta kestäneitä oireita esiintyi 13 %:lla. Näillä henkilöilllä hoito oli viivästynyt, heillä esiintyi usein radikuliittia ja selkäydinnesteessä kohonneita vasta-ainepitoisuuksia. Neuroborrelioosin hoitokustannukset olivat keskimäärin 500 000? tässä tutkimusryhmässä ja potilasta kohden 3 300?. Sosiaaliset kulut olivat keskimäärin 2 000?/henkilö. Taudin varhainen diagnostiikka vähentäisi huomatttavasti sairastuneiden kärsimyksiä ja yhteiskunnan taloudellisia menoja.
Clin Microbiol Infect. 2009 Sep 29. [Epub ahead of print]
Neuroborreliosis - an epidemiological, clinical and health economical study from an endemic area in the south-east of Sweden.
Henningsson AJ, Malmvall BE, Ernerudh J, Matussek A, Forsberg P.
Department of Infectious Diseases, Ryhov County Hospital, Jönköping, Sweden.
We studied retrospectively the medical records of all patients diagnosed with neuroborreliosis (NB) by cerebrospinal fluid (CSF) analysis in Jönköping County, Sweden, during 2000-2005 (n=150). The number of NB cases increased from 5 to 10/100,000 inhabitants/year. In 17% of the patients, Borrelia-antibodies were found in CSF but not in serum at the time of diagnosis. Facial palsy, headache and fever were frequent manifestations in children, whereas unspecific muscle and joint pain were the most commonly reported symptoms in older patients. Symptoms persisting more than six months post-treatment occurred in 13%, and these patients were significantly older, had longer duration of symptoms prior to treatment, higher levels of Borrelia-specific IgG in CSF and more often radiculitis. The total cost for NB-related health care was estimated to 500,000 EUR for the entire study group (3,300 EUR/patient), and the cost for social benefits to 134,000 EUR (2,000 EUR/patient). CSF analysis is necessary for NB diagnosis since some patients develop antibodies in serum later than in CSF. Early diagnosis of borreliosis would result in reduced human suffering and economic gain.
PMID: 19793326 [PubMed - as supplied by publisher]
Clin Microbiol Infect. 2009 Sep 29. [Epub ahead of print]
Neuroborreliosis - an epidemiological, clinical and health economical study from an endemic area in the south-east of Sweden.
Henningsson AJ, Malmvall BE, Ernerudh J, Matussek A, Forsberg P.
Department of Infectious Diseases, Ryhov County Hospital, Jönköping, Sweden.
We studied retrospectively the medical records of all patients diagnosed with neuroborreliosis (NB) by cerebrospinal fluid (CSF) analysis in Jönköping County, Sweden, during 2000-2005 (n=150). The number of NB cases increased from 5 to 10/100,000 inhabitants/year. In 17% of the patients, Borrelia-antibodies were found in CSF but not in serum at the time of diagnosis. Facial palsy, headache and fever were frequent manifestations in children, whereas unspecific muscle and joint pain were the most commonly reported symptoms in older patients. Symptoms persisting more than six months post-treatment occurred in 13%, and these patients were significantly older, had longer duration of symptoms prior to treatment, higher levels of Borrelia-specific IgG in CSF and more often radiculitis. The total cost for NB-related health care was estimated to 500,000 EUR for the entire study group (3,300 EUR/patient), and the cost for social benefits to 134,000 EUR (2,000 EUR/patient). CSF analysis is necessary for NB diagnosis since some patients develop antibodies in serum later than in CSF. Early diagnosis of borreliosis would result in reduced human suffering and economic gain.
PMID: 19793326 [PubMed - as supplied by publisher]
Beta-laktamaasia tuottavat bakteerit saattavat olla avainasemassa sekainfektioissa. Niiden vaikutus voi olla suora tai epäsuora. Tällaiset bakteerit kykenevät selviytymään antibioottihoidoista (in vivo ja in vitro) ja ne myös suojelevat muita antibiooteille herkkiä bakteereja vapauttamalla entsyymejä. Ilmiötä on tavattu ylemmissä hengitystieinfektioissa, ihossa, pehmytkudoksissa, leikkauksen jälkeisissä infektioissa jne. Tutkimuksissa on todettu toistuvasti antibioottihoitojen epäonnistumisia tällaisissa tapauksissa.
The role of beta-lactamase-producing-bacteria in mixed infections
Itzhak Brook email
BMC Infectious Diseases 2009, 9:202doi:10.1186/1471-2334-9-202
Published: 14 December 2009
Abstract (provisional)
Beta-lactamase-producing bacteria (BLPB) can play an important role in polymicrobial infections. They can have a direct pathogenic impact in causing the infection as well as an indirect effect through their ability to produce the enzyme beta-lactamase.
BLPB may not only survive penicillin therapy but can also, as was demonstrated in in vitro and in vivo studies, protect other penicillin-susceptible bacteria from penicillin by releasing the free enzyme into their environment. This phenomenon occurs in upper respiratory tract, skin, soft tissue, surgical and other infections. The clinical, in vitro, and in vivo evidence supporting the role of these organisms in the increased failure rate of penicillin in eradication of these infections and the implication of that increased rate on the management of infections is discussed.
The complete article is available as a provisional PDF. The fully formatted PDF and HTML versions are in production.
The role of beta-lactamase-producing-bacteria in mixed infections
Itzhak Brook email
BMC Infectious Diseases 2009, 9:202doi:10.1186/1471-2334-9-202
Published: 14 December 2009
Abstract (provisional)
Beta-lactamase-producing bacteria (BLPB) can play an important role in polymicrobial infections. They can have a direct pathogenic impact in causing the infection as well as an indirect effect through their ability to produce the enzyme beta-lactamase.
BLPB may not only survive penicillin therapy but can also, as was demonstrated in in vitro and in vivo studies, protect other penicillin-susceptible bacteria from penicillin by releasing the free enzyme into their environment. This phenomenon occurs in upper respiratory tract, skin, soft tissue, surgical and other infections. The clinical, in vitro, and in vivo evidence supporting the role of these organisms in the increased failure rate of penicillin in eradication of these infections and the implication of that increased rate on the management of infections is discussed.
The complete article is available as a provisional PDF. The fully formatted PDF and HTML versions are in production.
"Kroonisia esim. autoimmuunitauteja, neurologisia tai psyykkisiä sairauksia sairastavilla on yleisesti systeemisiä ja keskushermostoperäisiä bakteeri-ja virusinfektioita. Sairastuneilta löydetään yleisesti esim. borreliabakteereita, mykoplasmaa, keuhkoklamydiaa, herpesviruksia jne. (2009)"
Role of Chronic Bacterial and Viral Infections in Neurodegenerative, Neurobehavioral, Psychiatric, Autoimmune and Fatiguing Illnesses: Part 1
Garth L. Nicolson and Jörg Haier
BJMP 2009:2(4) 20-28
(BJMP=British Journal of Medical Practitioners)
ABSTRACT
Chronically ill patients with neurodegenerative, neurobehavioral and psychiatric diseases commonly have systemic and central nervous system bacterial and viral infections. In addition, other chronic illnesses where neurological manifestations are routinely found, such as fatiguing and autoimmune diseases, Lyme disease and Gulf War illnesses, also show systemic bacterial and viral infections that could be important in disease inception and progression or in increasing the number and severity of signs and symptoms. Evidence of Mycoplasma species, Chlamydia pneumoniae, Borrelia burgdorferi, human herpesvirus-1, -6 and -7 and other bacterial and viral infections revealed high infection rates in the above illnesses that were not found in controls.
Although the specific roles of chronic infections in various diseases and their pathogeneses have not been carefully determined, the data suggest that chronic bacterial and/or viral infections are common features of progressive chronic diseases.
Role of Chronic Bacterial and Viral Infections in Neurodegenerative, Neurobehavioral, Psychiatric, Autoimmune and Fatiguing Illnesses: Part 1
Garth L. Nicolson and Jörg Haier
BJMP 2009:2(4) 20-28
(BJMP=British Journal of Medical Practitioners)
ABSTRACT
Chronically ill patients with neurodegenerative, neurobehavioral and psychiatric diseases commonly have systemic and central nervous system bacterial and viral infections. In addition, other chronic illnesses where neurological manifestations are routinely found, such as fatiguing and autoimmune diseases, Lyme disease and Gulf War illnesses, also show systemic bacterial and viral infections that could be important in disease inception and progression or in increasing the number and severity of signs and symptoms. Evidence of Mycoplasma species, Chlamydia pneumoniae, Borrelia burgdorferi, human herpesvirus-1, -6 and -7 and other bacterial and viral infections revealed high infection rates in the above illnesses that were not found in controls.
Although the specific roles of chronic infections in various diseases and their pathogeneses have not been carefully determined, the data suggest that chronic bacterial and/or viral infections are common features of progressive chronic diseases.
Borreliabakteerin tiedetään aiheuttavan kroonisia infektioita eri puolilla elimistöä. Selviytyäkseen elimistössä bakteerin täytyy kyetä pakenemaan immuunipuolustuksen hyökkäyksiltä. Uudessa suomalaisessa tutkimuksessa: Pietikäinen, Meria, Blomb, Meria 2010, borreliabakteereiden todettiin sitoutuvan C4bp proteiiniin. Sen avulla bakteeri selviytyy elimistössä vasta-aineiden muodostumisesta huolimatta. Erityisen voimakkaasti sitoutui B. garinii.
GModel
MIMM-3360; No. of Pages7
Molecular Immunology xxx (2009) xxx?xxx
Contents lists available at ScienceDirect
Molecular Immunology
journal homepage: www.elsevier.com/locate/molimm
Binding of the complement inhibitor C4b-binding protein to Lyme
disease borreliae
Johanna Pietikäinena,1, Taru Meria,∗,1, Anna M. Blomb, Seppo Meria
a Infection Biology Research Program, Haartman Institute, Department of Bacteriology and Immunology,
University of Helsinki and HUSLAB, Helsinki, Finland
b Department of Clinical Chemistry, University Hospital Malmö, University of Lund, Malmö, Sweden
a r t i c l e i n f o
Article history:
Received 8 October 2009
Received in revised form
19 November 2009
Accepted 21 November 2009
Available online xxx
Keywords:
Innate immunity
Infection
Immune evasion
a b s t r a c t
The Lyme disease spirochetes, Borrelia burgdorferi sensu stricto, Borrelia afzelii and Borrelia garinii, are tickborne
pathogens that can cause chronic disseminated infections. To survive in the human host borreliae
need to evade the immune system. It is already well known that B. burgdorferi ss. and B. afzelii bind
the complement (C) alternative pathway inhibitor factor H from serum using OspE and CRASP-1/Bba68
proteins to escape C attack. In the presence of natural antibodies and in chronic infections, when specific
antibodies develop, borreliae have to protect themselves from antibody-induced classical pathway C
attack.
In this study we demonstrate binding of the classical pathway inhibitor, C4b-binding protein (C4bp),
to three genospecies of B. burgdorferi sensu lato. Binding was strongest to B. garinii, which has
been found to be the weakest factorHbinder. The bacteria bound both purified 125I-labeled C4bp and C4bp
from serum. Unlabeled C4bp competed for binding with 125I-C4bp, whereas BSA had no effect. Binding
was salt-sensitive and inhibited by C4b and partially by heparin. C4bp maintained its cofactor activity for
factor I in cleaving C4b when bound to the bacterial surface. Ligand blotting analysis of whole cell lysates
and fractionated outer cell membranes of the bacteria suggested one major receptor of approximately
43 kDa (P43) for C4bp in B. garinii and B. burgdorferi sensu stricto. Binding of C4bp may thus allow Lyme
disease borreliae to escape activation of the classical C pathway and allow chronic infections in humans
even in the presence of specific antibodies.
© 2009 Elsevier Ltd. All rights reserved.
1. Introduction
Lyme borreliosis is a tick-borne multisystemic infection. It is
caused by three genospecies of the Borrelia burgdorferi sensu lato
complex: B. burgdorferi sensu stricto, Borrelia garinii or Borrelia
afzelii (Steere, 1989). The spirochetes are transmitted to humans
by the bites of the Ixodes group ticks. Erythema migrans occurring
at the initial site of a tick bite is the first and the most common
symptom of borreliosis occurring in about 50?70% of cases. Clinical
manifestations of the disseminated disease differ depending on
the causative genospecies. B. burgdorferi sensu stricto causes mainly
Abbreviations: C4bp, C4b-binding protein; C, complement; CP, classical pathway;
AP, alternative pathway; MAC, membrane attack complex; FHL-1, factor H-like
protein 1; CNS, central nervous system; SCR, short consensus repeat; BSA, bovine
serum albumin; FI, factor I; NHS, normal human serum; HI-NHS, heat-inactivated
NHS; ECL, enhanced chemiluminescence.
∗ Corresponding author at: Haartman Institute, Department of Bacteriology and
Immunology, P.O. Box 21, Haartmaninkatu 3, FIN-00014 University of Helsinki,
Helsinki, Finland. Tel.: +358 9 1912 6395; fax: +358 9 191 26382.
E-mail address: taru.meri@helsinki.fi (T. Meri).
1 These authors contributed equally.
arthritis, while B. garinii is associated with neurological symptoms
and B. afzelii with skin manifestations.
Complement (C) is an important part of the innate immunity
as it protects the host from microbial infections by directly killing
targets, marking them for phagocytosis and by enhancing inflammatory
reactions. The C system can be activated via the classical
(CP), alternative (AP) or the lectin pathway. Activation of C leads to
C3-amplification that promotes formation of the membrane attack
complexes and direct lysis of the targets. During prolonged infections
antibodies against borreliae develop and could activate the
CP. As borreliae do not have capsules or a peptidoglycan layer for
their defense against C, evasion of the C system by specific membrane
proteins has been considered to be especially important for
the virulence of borreliae.
B. burgdorferi sensu stricto and B. afzelii gain protection against
the AP by binding the AP inhibitors factor H (FH) (Hellwage et al.,
2001) and factor H-like protein (FHL-1) to their surfaces (Alitalo et
al., 2001). The resistance of borreliae to lysis in nonimmune serum
has been shown to correlate with the binding of FH and FHL-1. The
receptors for FH belong to two distinct classes of proteins: cp32 circular
plasmid-encoded OspE-family (Hellwage et al., 2001) and the
lp54 linear plasmid-encoded CRASP-1/Bba68 proteins (Kraiczy et
al., 2004). In addition, a third type of a putative FH-binding protein
2. Materials and methods
2.1. Bacterial strains
B. burgdorferi sensu stricto strains (B31, 297, N40) and a tick
isolate B. afzelii (600) were kind gifts from docent Ilkka Seppälä
from our department. B. afzelii (BaA91, 600, 1082) and B. garinii
strains (Bg40, Bg46, Bg50) were isolated from skin biopsies of
Finnish patients and they were kind gifts from Prof. Matti Viljanen
(Department of Microbiology, University of Turku, Finland). All
strains were grown at +33 ◦C in BSK-H complete medium (Sigma,
St. Louis, MO). Whole cell lysates were prepared by washing the
bacteria five times with VBS before diluting them in VBS (approx.
1×109 bacteria/500l). Complete EDTA-free protease inhibitor
coctail was added to the suspension prior to sonication, which was
done using a Soniprep 150 ultrasonic disintegrator (MSE, London,
UK) five times/strain with an amplitude of 5m for 5 s.
2.2. Proteins, antibodies and buffers
Bovine serum albumin (BSA) and heparin were purchased
from Sigma. C4bp was purified from human plasma as described
(Dahlback, 1983). C4b and factor I were from Quidel (San Diego,
CA, USA). C4bp and C4b were labeled with 125I using the Iodogen
method (Pierce Chemical Corp., Rockford, IL) (Salacinski et al.,
1981). Sheep polyclonal anti-C4bp antibody was from The Binding
Site (Birmingham, UK). HRP-conjugated donkey anti-sheep
IgG antibody was from the Jackson Immunoresearch Laboratories
(Cambridgeshire, UK). Veronal-buffered saline (VBS) contained
145mM NaCl and 5mM barbiturate, pH 7.4. Phosphate-buffered
saline (PBS) contained 120mMNaCl and 30mMphosphate, pH 7.3.
Normal human serum (NHS) was collected from healthy laboratory
personnel, pooled and stored at −70 ◦C prior usage. To inactivate C
serum was incubated at +55 ◦C for 30 min (heat-inactivated NHS,
HI-NHS). IgG was depleted from NHS (containing 0.5M EDTA, pH
7.7) using Protein G Sepharose 4 Fast Flow colum (Amersham
Biosciences, Uppsala, Sweden) according to the manufacturer?s
instructions. The serum was passed through the column three
times, with elutions in between 20mM sodium phosphate, pH
7.0, was used as the binding buffer. Complete EDTA-free protease
inhibitor cocktail was from Roche Diagnostics GmbH, Mannheim,
Germany.
2.3. Absorption of C4bp from serum
The bacteria (approx. 5×108 assay) were washed five times
with VBS and incubated with HI-NHS (at a 1:2 dilution) for 60 min
at 37 ◦C on a shaker (750 rpm). The bacteria were washed five
times with VBS, and the last wash fractions were collected. Proteins
bound to the surfaces of the bacteria were eluted with 0.1M
glycine?HCl, pH 2 (15 min at RT). After centrifugation (8000×g,
4min) the supernatants were collected. Wash and elute fractions
were subjected to a non-reducing SDS-PAGE and transferred to
nitrocellulose membranes. Nonspecific binding was blocked by
incubating the membranes in 5% fat-free milk in PBS (1?12 h, RT
or +4 ◦C). Thereafter, the membranes were incubated with a polyclonal
sheep anti-C4bp antibody (at a dilution of 1:5000) for 12 h
at 4 ◦C or 1h at +37◦C. After three washes with PBS/0.05%Tween
20, and three washes with PBS, a HRP-conjugated donkey antisheep
IgG antibody was added at a 1:5000 dilution. The membranes
were incubated for 3 h at RT. After one wash with PBS/0.05%Tween
20 and three washes with PBS, the antibodies were detected by
an enhanced chemiluminescence (ECL) method: the immunoblot
was incubated for 5?15 min at 22 ◦C with a substrate solution
containing nitroblue tetrazolium (Sigma) and 5-bromo-4-chloro-
3-indolyl phosphate (Boehringer Mannheim GmbH, Mannheim,
Germany), each dissolved in dimethyl formamide (Merck, Darmstadt,
Germany) and finally diluted into 0.1M NaHCO3 buffer (pH
9.7) containing 1mM MgCl2.
2.4. Direct 125I-C4bp-binding assays
The spirochetes (1.25×108 bacteria/assay) were washed three
times with VBS and incubated in 1/3 VBS containing 0.1% gelatin
(1/3 GVBS) for 30 min at 37 ◦C on a shaker (750 rpm) with
125I-C4bp (approx. 20,000 cpm/assay). In the inhibition assays unlabeled
C4bp, BSA, C4b (0.1?10g/ml) or heparin (10?200 IU/ml)
were added to the reaction mixture. In the salt inhibition assay
the bacteria were incubated with 125I-C4bp in increasing NaCl
concentrations (50?450 mM). After incubation the bacteria were
centrifuged (10,600×g, 4 min) through 20% sucrose gradients in
1/3 GVBS. Radioactivity was measured from the pellets and the
supernatants with a gammacounter. The ratios of the bound (pellet)
to the total (pellet + supernatant) radioactivities were calculated.
2.5. Analysis of cofactor activity for C4b cleavage
The functional activity of borrelia-bound C4bp was tested as
its ability to promote inactivation of C4b by factor I. The bacteria
(approx. 1×109 assay−1) were washed three times with VBS
and incubated with HI-NHS (at a dilution 1:2) or purified C4BP
(75g/ml) for 60 min at 37 ◦C on a shaker (750 rpm). As a negative
control the bacteria were incubated with VBS. The bacteria
were washed three times with VBS and incubated further with
125I-C4b (approx. 50,000 cpm/assay) and factor I (1g/reaction) at
37 ◦C for 60 min. The mixtures were centrifuged (8000×g, 5 min),
and the supernatants were subjected to reducing SDS-PAGE elec
trophoresis. The gel was fixed with 5% acetic acid for 30 min, dried
and subjected to autoradiography. Cleavage of C4b was analyzed by
the appearance of a 43 kDa cleavage fragment. As a positive control
125I-C4b was incubated with purified C4bp (7.5#g) and factor
I (1#g). As a negative control 125I-C4b was incubated with FI alone
in 100#l of VBS.
2.6. Sucrose density gradient fractionation of borreliae outer
membranes
Borrelial outer cell membranes were separated from protoplasmic
cylinders by ultracentrifugation as described (Radolf
et al., 1995). Approximately 1×109 borrelia spirochetes
were washed three times with VBS and suspended in 0.5 ml
ice-cold outer membrane buffer consisting of 10mM Hepes
(N-hydroxyethylpiperazine-N#-2-ethanesulphonic acid), 150mM
NaCl, 1mM MgCl2 (pH 7.4), protease inhibitors and 20% (wt/vol)
sucrose. The bacteria were incubated for 1 h after which 0.5 ml
aliquots were added on tops of linear gradients containing 20?60%
sucrose and a protease inhibitor cocktail. The tubes were centrifuged
at 30,000rpm for 18 h. After warming the tubes to room
temperature 0.6 ml fractions were collected starting from the top.
2.7. Ligand blotting test for C4bp binding
Solubilizates of spirochetes or sucrose density gradient
fractions were subjected to non-reducing SDS-PAGE
and transferred to nitrocellulose membranes. After incubating
the membranes in 5% milk in PBS (1.5 h, RT), 30% HI-NHS
depleted of IgG in 5% milk PBS was added (12 h, +4 ◦C). After three
washes with PBS/0.05% Tween 20 and three washes with PBS a
polyclonal sheep anti-C4bp was added (1:5000) and the Western
blotting was continued as described above.
3. Results
3.1. B. burgdorferi sensu stricto, B. afzelii and B. garinii bind C4bp
from normal human serum
To study whether the three major genospecies of Borrelia bind
the CP inhibitor C4bp from serum representative strains of each
type were incubated in HI-NHS. After extensive washing bound
proteins were eluted. The wash and elute fractions were subjected
to a non-reducing SDS-PAGE and Western blotting with an anti-
C4bp antibody. B. burgdorferi sensu stricto (B31, N40, 297), B. afzelii
(A91, 600, 1082) and B. garinii (40, 46, 50) strains acquired C4bp to
their surfaces as observed by the presence of C4bp in elute fractions
(Fig. 1). The intensities of the C4bp bands in the eluate fractions
showed strain-specific variation, which did not clearly correlate
with the different genospecies.
3.2. Binding of purified C4bp
To test the binding of purified C4bp to borrelia strains, C4bp was
radiolabeled with iodine and incubated with the bacteria (approx.
1.25×108 assay) under hypotonic circumstances (1/3GVBS). To
separate unbound 125I-C4bp from the bacteria-bound 125I-C4bp,
mixtures were centrifuged through 20% sucrose. The 125I-C4bp
bound clearly to all the tested strains (Fig. 2A). B. garinii (46, 50), B.
afzelii (A91, 600, 1082) and B. burgdorferi sensu stricto (B31, N40) all
bound a large proportion of the offered 125I-C4bp (range: 23?67%).
B. garinii strains (strain 50: 65.3%±0.6, n = 3) bound 125I-C4bp more
strongly than B. afzelii (strain 600: 45.2%±1.6, n = 3) and B. burgdorferi
sensu stricto (strain B31: 26.6%±3.9, n = 3). To verify that the
binding of C4bp was specific we performed a competition assay
where purified non-labeled C4bp was incubated together with the
Fig. 1. Binding of C4bp from human serum to various Borrelia strains. (A) B. burgdorferi
sensu stricto (strains B31, 297, N40), (B) B. garinii (strains g50, g40, g46) and (C)
B. afzelii (strains A91, 600, 1082) were incubated in heat-inactivated NHS or VBS.
After incubation the bacteria were washed extensively and possibly bound C4bp
was eluted. Proteins in the last wash and the elute fractions were detected with
a polyclonal anti-C4bp antibody. Binding was seen to all strains but with variable
intensities. No nonspecific binding of the detection antibodies to any secreted bacterial
components in the VBS-controls was seen. Only one representative VBS control
of each genospecies is shown.
spirochetes using two representative strains of B. burgdorferi sensu
stricto (B31, N40), B. garinii (g46, g50), three strains of B. afzelii (A91,
1082, 600) and 125I-C4bp. As shown in Fig. 2B?D, non-labeled C4bp
reduced binding of 125I-C4bp to bacteria in a dose-dependent manner
indicating a specific interaction. BSA, tested as a control, had no
effect on the binding of 125I-C4bp.
3.3. The effect of salt and heparin and C4b on binding
To study whether binding of C4bp to borreliae was of ionic
nature we tested the effect of salt on binding of C4bp to B.
burgdorferi sensu stricto strain B31. The binding of 125I-C4bp was
significantly reduced under hypertonic circumstances at 450mM
NaCl (7.5%±1.8 at 150mM vs. 21.8%±1.9 at 450mM) (Fig. 3A).
Furthermore, a reduction of 80% in binding was seen under isotonic
vs. hypotonic (50mMNaCl) conditions. The result thus showed that
the interaction of C4bp with borrelia spirochetes is ionic in nature.
We obtained similar results using another strain of B. burgdorferi
sensu stricto (N40) as well as B. garinii strains g46, g50 (results not
shown). Importantly, however, considerable binding still occurs
under physiological conditions.
C4bp has a heparin and a C4b-binding site in its #-chains at
the SCR domains 1?2. To study if the heparin site is involved in
binding of C4bp to borreliae we tested the effect of increasing
heparin concentrations on the interaction using B. burgdorferi sensu
stricto strain B31. Increasing amounts of heparin were added to
the reaction mixture prior incubation with 125I-C4bp. As shown
in Fig. 3B heparin inhibited binding of 125I-C4bp to B. burgdorferi
sensu stricto strain B31 (65% of binding was inhibited at the
highest heparin concentration tested). C4b added to the reaction
mixture (0.1, 1 and 10g/ml) also inhibited the binding of 125IC4bp
in a dose-dependent manner (Fig. 3C). Heparin and C4b also
inhibited binding of C4bp with two other borreliae strains tested (B.
burgdorferi s.s. strain N40 and B. garinii strain g40; data not shown).
Taken together these results suggest that the binding sites for hep-
Fig. 3. The effects of increasing salt concentration, heparin and C4b on the binding
of 125I-C4bp to B. burgdorferi sensu stricto strain B31. B. burgdorferi sensu stricto
(B31) was incubated with 125I-C4bp in the presence of varying amounts of NaCl (A),
heparin (B) or C4b (C). Cell-bound C4bp was determined as in Fig. 2 and binding in
the absence of inhibitor was set as 100%.
arin and the borrelial receptor(s) on C4bp are at least partially
overlapping.
3.4. Bound C4bp maintains cofactor activity for C4b cleavage
We next studied if C4bp bound to the surface of bacteria
maintained cofactor activity for factor I in the cleavage of C4b.
Spirochetes were incubated in HI-NHS or with purified C4bp where
after they were washed and incubated further with 125I-C4b and
factor I. Supernatants were subjected SDS-PAGE analysis under
reducing conditions and cleavage of the 125I-C4b was detected by
autoradiography. As shown in Fig. 4, bacteria preincubated in HINHS
or with purified C4bp showed cofactor activity for the cleavage
of C4b as seen by the reduction in the -chain and the appearance
of the 45 kDa C4d and other cleavage fragments of the C4b-chain.
The cleavage fragments were similar to those produced by purified
C4bp with factor I. Radiolabeled C4b was not cleaved when factor
I was not added to the reaction mixture or when the bacteria were
preincubated with VBS alone, indicating the lack of endogenous
C4b cleaving activity in the tested borrelia strains.
3.5. The receptor for C4bp in B. garinii and B. burgdorferi sensu
stricto
To detect a possible receptor for C4bp we next solubilized and
fractionated bacteria and studied C4bp binding to membrane fractions.
The solubilized outer membranes of B. garinii spirochetes
were fractionated by sucrose density gradient centrifugation. The
fractions were subjected to a non-reducing SDS-PAGE, transferred
to nitrocellulose membranes and incubated with HI-NHS depleted
of IgG to prevent nonspecific interactions by serum antibodies. The
binding of C4bp to the outer membrane proteins was analyzed
using a polyclonal anti-C4bp antibody. As seen in Fig. 5A, B. Garinii
(strain g50) solubilizate and its fractions 13 and 14 showed a prominent
band of approximately 43 kDa suggesting that it corresponds
to a potential receptor for C4bp in B. garinii. A major putative receptor
of 43 kDa was seen also with B. burgdorferi sensu stricto strain
B31 (Fig. 5B). Control blots incubated without HI-NHS or without
the first antibody were clear of bands (not shown).
The major C4bp-binding band of approximately 43 kDa was
shared by B. garinii g50, B. garinii g46, B. burgdorferi sensu stricto
B31 and weakly by B. burgdorferi sensu stricto N40 (Fig. 6). When
compared to B. garinii g50 sugar density gradient fractions 13 and
14, the major band was of similar size and apparently represents
the same protein.
4. Discussion
In the present report, we describe the binding of the classical
pathway inhibitor C4bp to the surface of Borrelia spirochetes, which
is a novel interaction between borrelia and the C system. The borreliae
bound C4bp from human serum with a putative receptor of
43 kDa, tentatively labeled as P43. When tested with purified C4bp
it was seen that binding was specific and sensitive to salt and heparin
indicating that it is primarily of ionic nature. C4bp maintained
its cofactor activity for factor I in the cleavage of C4b while bound
to the borrelial surface. These results thus suggest that in addition
to the previously well defined utilization of FH and FHL-1, binding
of C4bp is a novel C evasion mechanism of B. burgdorferi. Binding
of C4bp would particularly control activation of the classical and
lectin pathways of complement.
In the many disease manifestations of borreliosis, symptoms are
thought to result from the presence of spirochetes in various tissues
(Bolz and Weis, 2004). The bacteria invade joints, heart and the CNS
after hematogenous dissemination. Even in the absence of specific
antibodies, as in the early infections, the CP of C can be activated
via direct C1q binding to the target, by natural antibodies (IgM) or
by CRP during an acute phase reaction. Activation of the mannanbinding
lectin pathway has not been reported and may be unlikely
because the borrelial outer membrane does not contain mannan.
On the other hand, this pathway cold become activated by ficolins
if they bind to borrelial surfaces. Although antibody formation
against borreliae is slow, IgG antibodies are formed after bacterial
dissemination. New IgM and IgG antibodies continue to appear
after months to years in chronically ill patients and can reach relatively
high levels. Kochi and Johnson (1988) demonstrated a role
for specific IgG in classical C pathway-mediated killing of serum
resistant borrelial strains by enhanced MAC formation. However,
Brade et al. (1992) did not find differences in the bactericidal effects
of immune and nonimmune sera. Many studies, however, point
towards a protective role of immune sera against borrelial reinfection.
IgG antibodies could prevent relapses of infection by initiating
a fully bactericidal C activation. In most cases, however, activation
is controlled at the C3-amplification loop level by FH and FHL-1. The
efficiency of antibodies in activating C depends on the nature and
stability of the target antigens. The target antigens could include
also borrelial inhibitors of C, whereby killing of the bacteria would
be enhanced if the inhibitory activities are neutralized.
Relapsing fever spirochetes are able to vary their outer surface
proteins to a much greater extent than Lyme disease spirochetes.
It has been thought that because relapsing fever borreliae evade
CP by varying their variable outer surface proteins, they are able
to cause more severe infections. Multiple fever episodes and reappearances
in blood are characteristic to the disease caused by these
spirochetes until they have used all possible combinations of their
variable proteins. As we have shown recently, it is, however, possible
that relapsing fever spirochetes are unduly resistant to C
because they are able to bind also C4bp from human serum (Meri
et al., 2006).
Serum sensitivity of the different genospecies of B. burgdorferi
varies. B. burgdorferi sensu stricto and B. afzelii have in earlier studies
been found to be serum resistant, while B. garinii has in these
assays been serum sensitive (Alitalo et al., 2001; Breitner-Ruddock
et al., 1997; vanDamet al., 1997). Serum sensitivity has been shown
to correlate with the ability of the bacteria to bind the AP inhibitor
FH. B. burgdorferi sensu stricto and B. afzelii express the FH-binding
proteins OspE and Bba68/CRASP-1 (Hellwage et al., 2001; Kraiczy
et al., 2003), whereas B. garinii has in most studies been shown not
to bind FH or FHL-1. In our recent report, however, neurovirulent
B. garinii strains were found to express FH-binding proteins, but
their overall FH-binding capacity was weaker when compared to B.
afzelii and B. burgdorferi sensu stricto strains (Alitalo et al., 2005).
Depending on growth conditions, e.g. in vivo vs. in vitro, Borrelia
spirochetes seem to vary considerably the expression of their outer
surface proteins.
In this study B. garinii was found to bind more C4bp than B.
afzelii or B. burgdorferi sensu stricto (Fig. 2), although all genospecies
bound a fairly high proportion of the offered 125I-C4bp under the
conditions used. Under similar conditions, the binding of FH has
been much weaker. The difference in C4bp-binding between B.
garinii and B. afzelii genospecies was not great, but the fact that B.
garinii is a weak binder of FH/FHL-1 makes it remarkable. Limited
expression of OspE and CRASP-1/Csp-1 makes B. garinii more susceptible
to lysis by the alternative C pathway. However, later in the
course of infection at least anti-OspE antibodies develop (Panelius
et al., 2008). Analogously, antibodies may develop against putative
C4bp-binding proteins, which would limit the spread of bacteria
in the body. B. garinii causes mainly neuroborreliosis. The central
nervous system is considered to be an immunoprivileged site. It is
a good place to escape host defenses because of nonlymphatic circulation
of fluids and lesser degree of C activation. We and others
have speculated earlier that this genospecies favors CNS because
there is less AP activation and a better possibility to hide in the
cerebrospinal space. Thus, preferential binding of C4bp to B. garinii
(versus B. afzelii and B. burgdorferi sensu stricto) could compensate
for the relative lack of FH-binding proteins in B. garinii. Notably, also
N. meningitidis, another gram-negative bacterium with preference
for CNS infections, binds C4bp (Jarva et al., 2005).
B. burgdorferi sensu stricto, B. garinii and B. afzelii bound C4bp
from whole human serum (Fig. 1). C4bp bound to bacterial surface
maintained its cofactor activity for fI in cleaving C4b (Fig. 5),
suggesting that enough active sites on C4bp are available for effector
functions. The most obvious function for bound C4bp would
be down regulation of CP activation in the bacterial microenvironment.
Gram-negative bacteria, including Borreliae, are generally
lysed by MAC unless C is specifically inhibited. On the other
hand, efficient phagocytosis under nonimmune conditions requires
opsonization by C components (Underhill and Ozinsky, 2002). By
interfering with C deposition borrelia can thus evade immune
defenses more efficiently. Studies with S. pyogenes have shown
that deposition of C occurs almost exclusively via CP but C4bp
bound to bacteria limits CP activation under nonimmune conditions
(Carlsson et al., 2003). C4bp-binding is thus associated with
phagocytosis resistance by streptococci. Other possible functions
for bacteria-bound C4bp, as Johnsson et al. (1996) proposed, could
be modification of coagulation using protein S bound to the -
chain of C4bp (Dahlback, 1991) and mediation of adhesion between
bacteria and a putative receptor on human cells.
The hypervariable N-terminal region on the M-protein has
been shown to be the main receptor site for C4bp on S. pyogenes
(Johnsson et al., 1996). It binds to the SCR1-2 domains of the-chain
of C4bp in a hydrophobic manner, which also involves the C4bbinding
site (Accardo et al., 1996). S. pyogenes uses M-protein to
bind not only C4bp but also immunoglobulins, C inhibitors FH and
FHL-1, fibrinogen, fibronectin and albumin (Kotarsky et al., 1998;
Thern et al., 1995). The FH-binding proteins of B. burgdorferi, OspE
and Bba68/CRASP-1 are 15?17 kDa and ∼27 kDa, respectively. The
putative C4bp-binding protein in borrelia was found to be∼43 kDa.
This C4bp-binding receptor P43 is thus different from the known
FH-binding proteins in borrelia
In contrast to the interaction between M-protein of S. pyogenes
and C4bp, the interaction between C4bp and borrelia was found to
be sensitive to salt. Salt sensitivity points to an interaction based
on ionic forces. This seems to be the case for a number of other
bacterium?C4bp interactions as well. For example, B. pertussis, the
agent causing whooping cough, binds C4bp through filamentous
hemagglutinin using charged amino acids at the junction of the -
chain SCR1-2 domains (Berggard et al., 2001). N. gonorrhoeae uses
two porin molecules to bind C4bp. The C4bp?Por1B interaction is
sensitive to both salt and heparin, whereas the C4bp?Por1A interaction
is hydrophobic and therefore insensitive to increasing salt
concentrations (Ngampasutadol et al., 2005). We observed that the
borrelia?C4bp interaction was sensitive to heparin, which binds to
SCR1-3, SCR2 being the most important domain (Blom et al., 2001).
Therefore, the binding sites on C4bp for a putative borrelial receptor
and heparin seem to overlap to some extent. Also, C4b competed
out 125I-C4bp in binding to C4bp pointing towards a shared binding
site between the putative receptor and C4b on C4bp. C4b has
been shown to bind to SCR1-3 (Blom et al., 2001). A cluster of positively
charged amino acids at the interface between SCR1 and SCR2was found
to be most important region for this highly salt-sensitive
interaction. It should be noted that multiple -chains in C4bp allow
the use of similar binding sites simultaneously as ligand sites for
bacteria and C4b. Experimentally, this was verified as the ability of
bacteria-bound C4bp to act as cofactor for C4b cleavage.
In summary, we have demonstrated, for the first time, binding
of the C classical pathway inhibitor C4bp to all genospecies of
Lyme disease causing borreliosis and identified a putative 43 kDa
receptor (P43) for C4bp. There are only few examples of microbes,
which utilize both AP and CP inhibitors. S. pyogenes as well as N.
gonorrhoeae binds both C4bp and FH. Binding of C4bp may help
B. burgdorferi to cause chronic infections even in the presence of
specific antibodies.
Acknowledgements
We thank Marjatta Ahonen for excellent technical assistance.
This researchwassupported by theAcademyof Finland in the frame
of the ERA-NET PathoGenoMics, Sigrid Juselius Foundation, Finnish
Cultural Foundation, Maud Kuistila Foundation, Helsinki University
Central Hospital Funds (EVO) and Finska Läkaresällskapet.
References
Accardo, P., Sanchez-Corral, P., Criado, O., Garcia, E., Rodriguez de Cordoba, S., 1996.
Binding of human complement component C4b-binding protein (C4BP) to Streptococcus
pyogenes involves the C4b-binding site. J. Immunol. 157, 4935?4939.
Alitalo, A., Meri, T., Comstedt, P., Jeffery, L., Tornberg, J., Strandin, T., Lankinen, H.,
Bergstrom, S., Cinco, M., Vuppala, S.R., Akins, D.R., Meri, S., 2005. Expression
of complement factor H binding immunoevasion proteins in Borrelia garinii
isolated from patients with neuroborreliosis. Eur. J. Immunol. 35, 3043?3053.
Alitalo, A., Meri, T., Ramo, L., Jokiranta, T.S., Heikkila, T., Seppala, I.J., Oksi, J., Viljanen,
M., Meri, S., 2001. Complement evasion by Borrelia burgdorferi: serum-resistant
strains promote C3b inactivation. Infect. Immun. 69, 3685?3691.
Berggard, K., Johnsson, E., Morfeldt, E., Persson, J., Stalhammar-Carlemalm, M., Lindahl,
G., 2001. Binding of human C4BP to the hypervariable region ofMprotein:
a molecular mechanism of phagocytosis resistance in Streptococcus pyogenes.
Mol. Microbiol. 42, 539?551.
Blom, A.M., Kask, L., Dahlback, B., 2001. Structural requirements for the complement
regulatory activities of C4BP. J. Biol. Chem. 276, 27136?27144.
Blom, A.M., Villoutreix, B.O., Dahlback, B., 2004. Complement inhibitor C4bbinding
protein-friend or foe in the innate immune system? Mol. Immunol. 40,
1333?1346.
Bolz, D.D., Weis, J.J., 2004. Molecular mimicry to Borrelia burgdorferi: pathway to
autoimmunity? Autoimmunity 37, 387?392.
Brade, V., Kleber, I., Acker, G., 1992. Differences of two Borrelia burgdorferi strains
in complement activation and serum resistance. Immunobiology 185, 453?
465.
Breitner-Ruddock, S., Wurzner, R., Schulze, J., Brade, V., 1997. Heterogeneity in the
complement-dependent bacteriolysis within the species of Borrelia burgdorferi.
Med. Microbiol. Immunol. (Berl.) 185, 253?260.
Carlsson, F., Berggard, K., Stalhammar-Carlemalm, M., Lindahl, G., 2003. Evasion
of phagocytosis through cooperation between two ligand-binding regions in
Streptococcus pyogenes M protein. J. Exp. Med. 198, 1057?1068.
Dahlback, B., 1983. Purification of human C4b-binding protein and formation of its
complex with vitamin K-dependent protein S. Biochem. J. 209, 847?856.
Dahlback, B., 1991. Protein S and C4b-binding protein: components involved in the
regulation of the protein C anticoagulant system. Thromb. Haemost. 66, 49?61.
Hartmann, K., Corvey, C., Skerka, C., Kirschfink, M., Karas, M., Brade, V., Miller, J.C.,
Stevenson, B., Wallich, R., Zipfel, P.F., Kraiczy, P., 2006. Functional characterization
of BbCRASP-2, a distinct outer membrane protein of Borrelia burgdorferi
that binds host complement regulators factor H and FHL-1. Mol. Microbiol. 61,
1220?1236.
Hellwage, J., Meri, T., Heikkila, T., Alitalo, A., Panelius, J., Lahdenne, P., Seppala, I.J.,
Meri, S., 2001. The complement regulator factor H binds to the surface protein
OspE of Borrelia burgdorferi. J. Biol. Chem. 276, 8427?8435.
Jarva, H., Ram, S., Vogel, U., Blom, A.M., Meri, S., 2005. Binding of the complement
inhibitor C4bp to serogroup B Neisseria meningitidis. J. Immunol. 174,
6299?6307.
Johnsson, E., Thern, A., Dahlback, B., Heden, L.O., Wikstrom, M., Lindahl, G., 1996. A
highly variable region in members of the streptococcal M protein family binds
the human complement regulator C4BP. J. Immunol. 157, 3021?3029.
Kochi, S.K., Johnson, R.C., 1988. Role of immunoglobulin G in killing of Borrelia
burgdorferi by the classical complement pathway. Infect. Immun. 56, 314?321.
Kotarsky, H., Hellwage, J., Johnsson, E., Skerka, C., Svensson, H.G., Lindahl, G., Sjobring,
U., Zipfel, P.F., 1998. Identification of a domain in human factor H and
factor H-like protein-1 required for the interaction with streptococcal M proteins.
J. Immunol. 160, 3349?3354.
Kraiczy, P., Hellwage, J., Skerka, C., Becker, H., Kirschfink, M., Simon, M.M., Brade,
V., Zipfel, P.F., Wallich, R., 2004. Complement resistance of Borrelia burgdorferi
correlates with the expression of BbCRASP-1, a novel linear plasmid-encoded
surface protein that interacts with human factor H and FHL-1 and is unrelated
to Erp proteins. J. Biol. Chem. 279, 2421?2429.
Kraiczy, P., Hellwage, J., Skerka, C., Kirschfink, M., Brade, V., Zipfel, P.F., Wallich,
R., 2003. Immune evasion of Borrelia burgdorferi: mapping of a complementinhibitor
factor H-binding site of BbCRASP-3, a novel member of the Erp protein
family. Eur. J. Immunol. 33, 697?707.
Lambris, J.D., Ricklin, D., Geisbrecht, B.V., 2008. Complement evasion by human
pathogens. Nat. Rev. Microbiol. 6, 132?142.
Meri, T., Cutler, S.J., Blom, A.M., Meri, S., Jokiranta, T.S., 2006. Relapsing fever
spirochetes Borrelia recurrentis and B. duttonii acquire complement regulators
C4b-binding protein and factor H. Infect. Immun. 74, 4157?4163.
Ngampasutadol, J., Ram, S., Blom, A.M., Jarva, H., Jerse, A.E., Lien, E., Goguen, J., Gulati,
S., Rice, P.A., 2005. Human C4b-binding protein selectively interacts with Neisseria
gonorrhoeae and results in species-specific infection. Proc. Natl. Acad. Sci.
U.S.A. 102, 17142?17147.
Panelius, J., Meri, T., Seppala, I., Eholuoto, M., Alitalo, A., Meri, S., 2008. Outer surface
protein E antibody response and its effect on complement factor H binding to
OspE in Lyme borreliosis. Microbes Infect. 10, 135?142.
Radolf, J.D., Goldberg, M.S., Bourell, K., Baker, S.I., Jones, J.D., Norgard, M.V., 1995.
Characterization of outer membranes isolated from Borrelia burgdorferi, the
Lyme disease spirochete. Infect. Immun. 63, 2154?2163.
Salacinski, P.R., McLean, C., Sykes, J.E., Clement-Jones, V.V., Lowry, P.J., 1981. Iodination
of proteins, glycoproteins, and peptides using a solid-phase oxidizing
agent, 1,3,4,6-tetrachloro-3 alpha,6 alpha-diphenyl glycoluril (Iodogen). Anal.
Biochem. 117, 136?146.
Steere, A.C., 1989. Lyme disease. N. Engl. J. Med. 321, 586?596.
Thern, A., Stenberg, L., Dahlback, B., Lindahl, G., 1995. Ig-binding surface proteins of
Streptococcus pyogenes also bind human C4b-binding protein (C4BP), a regulatory
component of the complement system. J. Immunol. 154, 375?386.
Underhill, D.M., Ozinsky, A., 2002. Phagocytosis of microbes: complexity in action.
Annu. Rev. Immunol. 20, 825?852.
van Dam, A.P., Oei, A., Jaspars, R., Fijen, C., Wilske, B., Spanjaard, L., Dankert, J., 1997.
Complement-mediated serum sensitivity among spirochetes that cause Lyme
disease. Infect. Immun. 65, 1228?1236.
GModel
MIMM-3360; No. of Pages7
Molecular Immunology xxx (2009) xxx?xxx
Contents lists available at ScienceDirect
Molecular Immunology
journal homepage: www.elsevier.com/locate/molimm
Binding of the complement inhibitor C4b-binding protein to Lyme
disease borreliae
Johanna Pietikäinena,1, Taru Meria,∗,1, Anna M. Blomb, Seppo Meria
a Infection Biology Research Program, Haartman Institute, Department of Bacteriology and Immunology,
University of Helsinki and HUSLAB, Helsinki, Finland
b Department of Clinical Chemistry, University Hospital Malmö, University of Lund, Malmö, Sweden
a r t i c l e i n f o
Article history:
Received 8 October 2009
Received in revised form
19 November 2009
Accepted 21 November 2009
Available online xxx
Keywords:
Innate immunity
Infection
Immune evasion
a b s t r a c t
The Lyme disease spirochetes, Borrelia burgdorferi sensu stricto, Borrelia afzelii and Borrelia garinii, are tickborne
pathogens that can cause chronic disseminated infections. To survive in the human host borreliae
need to evade the immune system. It is already well known that B. burgdorferi ss. and B. afzelii bind
the complement (C) alternative pathway inhibitor factor H from serum using OspE and CRASP-1/Bba68
proteins to escape C attack. In the presence of natural antibodies and in chronic infections, when specific
antibodies develop, borreliae have to protect themselves from antibody-induced classical pathway C
attack.
In this study we demonstrate binding of the classical pathway inhibitor, C4b-binding protein (C4bp),
to three genospecies of B. burgdorferi sensu lato. Binding was strongest to B. garinii, which has
been found to be the weakest factorHbinder. The bacteria bound both purified 125I-labeled C4bp and C4bp
from serum. Unlabeled C4bp competed for binding with 125I-C4bp, whereas BSA had no effect. Binding
was salt-sensitive and inhibited by C4b and partially by heparin. C4bp maintained its cofactor activity for
factor I in cleaving C4b when bound to the bacterial surface. Ligand blotting analysis of whole cell lysates
and fractionated outer cell membranes of the bacteria suggested one major receptor of approximately
43 kDa (P43) for C4bp in B. garinii and B. burgdorferi sensu stricto. Binding of C4bp may thus allow Lyme
disease borreliae to escape activation of the classical C pathway and allow chronic infections in humans
even in the presence of specific antibodies.
© 2009 Elsevier Ltd. All rights reserved.
1. Introduction
Lyme borreliosis is a tick-borne multisystemic infection. It is
caused by three genospecies of the Borrelia burgdorferi sensu lato
complex: B. burgdorferi sensu stricto, Borrelia garinii or Borrelia
afzelii (Steere, 1989). The spirochetes are transmitted to humans
by the bites of the Ixodes group ticks. Erythema migrans occurring
at the initial site of a tick bite is the first and the most common
symptom of borreliosis occurring in about 50?70% of cases. Clinical
manifestations of the disseminated disease differ depending on
the causative genospecies. B. burgdorferi sensu stricto causes mainly
Abbreviations: C4bp, C4b-binding protein; C, complement; CP, classical pathway;
AP, alternative pathway; MAC, membrane attack complex; FHL-1, factor H-like
protein 1; CNS, central nervous system; SCR, short consensus repeat; BSA, bovine
serum albumin; FI, factor I; NHS, normal human serum; HI-NHS, heat-inactivated
NHS; ECL, enhanced chemiluminescence.
∗ Corresponding author at: Haartman Institute, Department of Bacteriology and
Immunology, P.O. Box 21, Haartmaninkatu 3, FIN-00014 University of Helsinki,
Helsinki, Finland. Tel.: +358 9 1912 6395; fax: +358 9 191 26382.
E-mail address: taru.meri@helsinki.fi (T. Meri).
1 These authors contributed equally.
arthritis, while B. garinii is associated with neurological symptoms
and B. afzelii with skin manifestations.
Complement (C) is an important part of the innate immunity
as it protects the host from microbial infections by directly killing
targets, marking them for phagocytosis and by enhancing inflammatory
reactions. The C system can be activated via the classical
(CP), alternative (AP) or the lectin pathway. Activation of C leads to
C3-amplification that promotes formation of the membrane attack
complexes and direct lysis of the targets. During prolonged infections
antibodies against borreliae develop and could activate the
CP. As borreliae do not have capsules or a peptidoglycan layer for
their defense against C, evasion of the C system by specific membrane
proteins has been considered to be especially important for
the virulence of borreliae.
B. burgdorferi sensu stricto and B. afzelii gain protection against
the AP by binding the AP inhibitors factor H (FH) (Hellwage et al.,
2001) and factor H-like protein (FHL-1) to their surfaces (Alitalo et
al., 2001). The resistance of borreliae to lysis in nonimmune serum
has been shown to correlate with the binding of FH and FHL-1. The
receptors for FH belong to two distinct classes of proteins: cp32 circular
plasmid-encoded OspE-family (Hellwage et al., 2001) and the
lp54 linear plasmid-encoded CRASP-1/Bba68 proteins (Kraiczy et
al., 2004). In addition, a third type of a putative FH-binding protein
2. Materials and methods
2.1. Bacterial strains
B. burgdorferi sensu stricto strains (B31, 297, N40) and a tick
isolate B. afzelii (600) were kind gifts from docent Ilkka Seppälä
from our department. B. afzelii (BaA91, 600, 1082) and B. garinii
strains (Bg40, Bg46, Bg50) were isolated from skin biopsies of
Finnish patients and they were kind gifts from Prof. Matti Viljanen
(Department of Microbiology, University of Turku, Finland). All
strains were grown at +33 ◦C in BSK-H complete medium (Sigma,
St. Louis, MO). Whole cell lysates were prepared by washing the
bacteria five times with VBS before diluting them in VBS (approx.
1×109 bacteria/500l). Complete EDTA-free protease inhibitor
coctail was added to the suspension prior to sonication, which was
done using a Soniprep 150 ultrasonic disintegrator (MSE, London,
UK) five times/strain with an amplitude of 5m for 5 s.
2.2. Proteins, antibodies and buffers
Bovine serum albumin (BSA) and heparin were purchased
from Sigma. C4bp was purified from human plasma as described
(Dahlback, 1983). C4b and factor I were from Quidel (San Diego,
CA, USA). C4bp and C4b were labeled with 125I using the Iodogen
method (Pierce Chemical Corp., Rockford, IL) (Salacinski et al.,
1981). Sheep polyclonal anti-C4bp antibody was from The Binding
Site (Birmingham, UK). HRP-conjugated donkey anti-sheep
IgG antibody was from the Jackson Immunoresearch Laboratories
(Cambridgeshire, UK). Veronal-buffered saline (VBS) contained
145mM NaCl and 5mM barbiturate, pH 7.4. Phosphate-buffered
saline (PBS) contained 120mMNaCl and 30mMphosphate, pH 7.3.
Normal human serum (NHS) was collected from healthy laboratory
personnel, pooled and stored at −70 ◦C prior usage. To inactivate C
serum was incubated at +55 ◦C for 30 min (heat-inactivated NHS,
HI-NHS). IgG was depleted from NHS (containing 0.5M EDTA, pH
7.7) using Protein G Sepharose 4 Fast Flow colum (Amersham
Biosciences, Uppsala, Sweden) according to the manufacturer?s
instructions. The serum was passed through the column three
times, with elutions in between 20mM sodium phosphate, pH
7.0, was used as the binding buffer. Complete EDTA-free protease
inhibitor cocktail was from Roche Diagnostics GmbH, Mannheim,
Germany.
2.3. Absorption of C4bp from serum
The bacteria (approx. 5×108 assay) were washed five times
with VBS and incubated with HI-NHS (at a 1:2 dilution) for 60 min
at 37 ◦C on a shaker (750 rpm). The bacteria were washed five
times with VBS, and the last wash fractions were collected. Proteins
bound to the surfaces of the bacteria were eluted with 0.1M
glycine?HCl, pH 2 (15 min at RT). After centrifugation (8000×g,
4min) the supernatants were collected. Wash and elute fractions
were subjected to a non-reducing SDS-PAGE and transferred to
nitrocellulose membranes. Nonspecific binding was blocked by
incubating the membranes in 5% fat-free milk in PBS (1?12 h, RT
or +4 ◦C). Thereafter, the membranes were incubated with a polyclonal
sheep anti-C4bp antibody (at a dilution of 1:5000) for 12 h
at 4 ◦C or 1h at +37◦C. After three washes with PBS/0.05%Tween
20, and three washes with PBS, a HRP-conjugated donkey antisheep
IgG antibody was added at a 1:5000 dilution. The membranes
were incubated for 3 h at RT. After one wash with PBS/0.05%Tween
20 and three washes with PBS, the antibodies were detected by
an enhanced chemiluminescence (ECL) method: the immunoblot
was incubated for 5?15 min at 22 ◦C with a substrate solution
containing nitroblue tetrazolium (Sigma) and 5-bromo-4-chloro-
3-indolyl phosphate (Boehringer Mannheim GmbH, Mannheim,
Germany), each dissolved in dimethyl formamide (Merck, Darmstadt,
Germany) and finally diluted into 0.1M NaHCO3 buffer (pH
9.7) containing 1mM MgCl2.
2.4. Direct 125I-C4bp-binding assays
The spirochetes (1.25×108 bacteria/assay) were washed three
times with VBS and incubated in 1/3 VBS containing 0.1% gelatin
(1/3 GVBS) for 30 min at 37 ◦C on a shaker (750 rpm) with
125I-C4bp (approx. 20,000 cpm/assay). In the inhibition assays unlabeled
C4bp, BSA, C4b (0.1?10g/ml) or heparin (10?200 IU/ml)
were added to the reaction mixture. In the salt inhibition assay
the bacteria were incubated with 125I-C4bp in increasing NaCl
concentrations (50?450 mM). After incubation the bacteria were
centrifuged (10,600×g, 4 min) through 20% sucrose gradients in
1/3 GVBS. Radioactivity was measured from the pellets and the
supernatants with a gammacounter. The ratios of the bound (pellet)
to the total (pellet + supernatant) radioactivities were calculated.
2.5. Analysis of cofactor activity for C4b cleavage
The functional activity of borrelia-bound C4bp was tested as
its ability to promote inactivation of C4b by factor I. The bacteria
(approx. 1×109 assay−1) were washed three times with VBS
and incubated with HI-NHS (at a dilution 1:2) or purified C4BP
(75g/ml) for 60 min at 37 ◦C on a shaker (750 rpm). As a negative
control the bacteria were incubated with VBS. The bacteria
were washed three times with VBS and incubated further with
125I-C4b (approx. 50,000 cpm/assay) and factor I (1g/reaction) at
37 ◦C for 60 min. The mixtures were centrifuged (8000×g, 5 min),
and the supernatants were subjected to reducing SDS-PAGE elec
trophoresis. The gel was fixed with 5% acetic acid for 30 min, dried
and subjected to autoradiography. Cleavage of C4b was analyzed by
the appearance of a 43 kDa cleavage fragment. As a positive control
125I-C4b was incubated with purified C4bp (7.5#g) and factor
I (1#g). As a negative control 125I-C4b was incubated with FI alone
in 100#l of VBS.
2.6. Sucrose density gradient fractionation of borreliae outer
membranes
Borrelial outer cell membranes were separated from protoplasmic
cylinders by ultracentrifugation as described (Radolf
et al., 1995). Approximately 1×109 borrelia spirochetes
were washed three times with VBS and suspended in 0.5 ml
ice-cold outer membrane buffer consisting of 10mM Hepes
(N-hydroxyethylpiperazine-N#-2-ethanesulphonic acid), 150mM
NaCl, 1mM MgCl2 (pH 7.4), protease inhibitors and 20% (wt/vol)
sucrose. The bacteria were incubated for 1 h after which 0.5 ml
aliquots were added on tops of linear gradients containing 20?60%
sucrose and a protease inhibitor cocktail. The tubes were centrifuged
at 30,000rpm for 18 h. After warming the tubes to room
temperature 0.6 ml fractions were collected starting from the top.
2.7. Ligand blotting test for C4bp binding
Solubilizates of spirochetes or sucrose density gradient
fractions were subjected to non-reducing SDS-PAGE
and transferred to nitrocellulose membranes. After incubating
the membranes in 5% milk in PBS (1.5 h, RT), 30% HI-NHS
depleted of IgG in 5% milk PBS was added (12 h, +4 ◦C). After three
washes with PBS/0.05% Tween 20 and three washes with PBS a
polyclonal sheep anti-C4bp was added (1:5000) and the Western
blotting was continued as described above.
3. Results
3.1. B. burgdorferi sensu stricto, B. afzelii and B. garinii bind C4bp
from normal human serum
To study whether the three major genospecies of Borrelia bind
the CP inhibitor C4bp from serum representative strains of each
type were incubated in HI-NHS. After extensive washing bound
proteins were eluted. The wash and elute fractions were subjected
to a non-reducing SDS-PAGE and Western blotting with an anti-
C4bp antibody. B. burgdorferi sensu stricto (B31, N40, 297), B. afzelii
(A91, 600, 1082) and B. garinii (40, 46, 50) strains acquired C4bp to
their surfaces as observed by the presence of C4bp in elute fractions
(Fig. 1). The intensities of the C4bp bands in the eluate fractions
showed strain-specific variation, which did not clearly correlate
with the different genospecies.
3.2. Binding of purified C4bp
To test the binding of purified C4bp to borrelia strains, C4bp was
radiolabeled with iodine and incubated with the bacteria (approx.
1.25×108 assay) under hypotonic circumstances (1/3GVBS). To
separate unbound 125I-C4bp from the bacteria-bound 125I-C4bp,
mixtures were centrifuged through 20% sucrose. The 125I-C4bp
bound clearly to all the tested strains (Fig. 2A). B. garinii (46, 50), B.
afzelii (A91, 600, 1082) and B. burgdorferi sensu stricto (B31, N40) all
bound a large proportion of the offered 125I-C4bp (range: 23?67%).
B. garinii strains (strain 50: 65.3%±0.6, n = 3) bound 125I-C4bp more
strongly than B. afzelii (strain 600: 45.2%±1.6, n = 3) and B. burgdorferi
sensu stricto (strain B31: 26.6%±3.9, n = 3). To verify that the
binding of C4bp was specific we performed a competition assay
where purified non-labeled C4bp was incubated together with the
Fig. 1. Binding of C4bp from human serum to various Borrelia strains. (A) B. burgdorferi
sensu stricto (strains B31, 297, N40), (B) B. garinii (strains g50, g40, g46) and (C)
B. afzelii (strains A91, 600, 1082) were incubated in heat-inactivated NHS or VBS.
After incubation the bacteria were washed extensively and possibly bound C4bp
was eluted. Proteins in the last wash and the elute fractions were detected with
a polyclonal anti-C4bp antibody. Binding was seen to all strains but with variable
intensities. No nonspecific binding of the detection antibodies to any secreted bacterial
components in the VBS-controls was seen. Only one representative VBS control
of each genospecies is shown.
spirochetes using two representative strains of B. burgdorferi sensu
stricto (B31, N40), B. garinii (g46, g50), three strains of B. afzelii (A91,
1082, 600) and 125I-C4bp. As shown in Fig. 2B?D, non-labeled C4bp
reduced binding of 125I-C4bp to bacteria in a dose-dependent manner
indicating a specific interaction. BSA, tested as a control, had no
effect on the binding of 125I-C4bp.
3.3. The effect of salt and heparin and C4b on binding
To study whether binding of C4bp to borreliae was of ionic
nature we tested the effect of salt on binding of C4bp to B.
burgdorferi sensu stricto strain B31. The binding of 125I-C4bp was
significantly reduced under hypertonic circumstances at 450mM
NaCl (7.5%±1.8 at 150mM vs. 21.8%±1.9 at 450mM) (Fig. 3A).
Furthermore, a reduction of 80% in binding was seen under isotonic
vs. hypotonic (50mMNaCl) conditions. The result thus showed that
the interaction of C4bp with borrelia spirochetes is ionic in nature.
We obtained similar results using another strain of B. burgdorferi
sensu stricto (N40) as well as B. garinii strains g46, g50 (results not
shown). Importantly, however, considerable binding still occurs
under physiological conditions.
C4bp has a heparin and a C4b-binding site in its #-chains at
the SCR domains 1?2. To study if the heparin site is involved in
binding of C4bp to borreliae we tested the effect of increasing
heparin concentrations on the interaction using B. burgdorferi sensu
stricto strain B31. Increasing amounts of heparin were added to
the reaction mixture prior incubation with 125I-C4bp. As shown
in Fig. 3B heparin inhibited binding of 125I-C4bp to B. burgdorferi
sensu stricto strain B31 (65% of binding was inhibited at the
highest heparin concentration tested). C4b added to the reaction
mixture (0.1, 1 and 10g/ml) also inhibited the binding of 125IC4bp
in a dose-dependent manner (Fig. 3C). Heparin and C4b also
inhibited binding of C4bp with two other borreliae strains tested (B.
burgdorferi s.s. strain N40 and B. garinii strain g40; data not shown).
Taken together these results suggest that the binding sites for hep-
Fig. 3. The effects of increasing salt concentration, heparin and C4b on the binding
of 125I-C4bp to B. burgdorferi sensu stricto strain B31. B. burgdorferi sensu stricto
(B31) was incubated with 125I-C4bp in the presence of varying amounts of NaCl (A),
heparin (B) or C4b (C). Cell-bound C4bp was determined as in Fig. 2 and binding in
the absence of inhibitor was set as 100%.
arin and the borrelial receptor(s) on C4bp are at least partially
overlapping.
3.4. Bound C4bp maintains cofactor activity for C4b cleavage
We next studied if C4bp bound to the surface of bacteria
maintained cofactor activity for factor I in the cleavage of C4b.
Spirochetes were incubated in HI-NHS or with purified C4bp where
after they were washed and incubated further with 125I-C4b and
factor I. Supernatants were subjected SDS-PAGE analysis under
reducing conditions and cleavage of the 125I-C4b was detected by
autoradiography. As shown in Fig. 4, bacteria preincubated in HINHS
or with purified C4bp showed cofactor activity for the cleavage
of C4b as seen by the reduction in the -chain and the appearance
of the 45 kDa C4d and other cleavage fragments of the C4b-chain.
The cleavage fragments were similar to those produced by purified
C4bp with factor I. Radiolabeled C4b was not cleaved when factor
I was not added to the reaction mixture or when the bacteria were
preincubated with VBS alone, indicating the lack of endogenous
C4b cleaving activity in the tested borrelia strains.
3.5. The receptor for C4bp in B. garinii and B. burgdorferi sensu
stricto
To detect a possible receptor for C4bp we next solubilized and
fractionated bacteria and studied C4bp binding to membrane fractions.
The solubilized outer membranes of B. garinii spirochetes
were fractionated by sucrose density gradient centrifugation. The
fractions were subjected to a non-reducing SDS-PAGE, transferred
to nitrocellulose membranes and incubated with HI-NHS depleted
of IgG to prevent nonspecific interactions by serum antibodies. The
binding of C4bp to the outer membrane proteins was analyzed
using a polyclonal anti-C4bp antibody. As seen in Fig. 5A, B. Garinii
(strain g50) solubilizate and its fractions 13 and 14 showed a prominent
band of approximately 43 kDa suggesting that it corresponds
to a potential receptor for C4bp in B. garinii. A major putative receptor
of 43 kDa was seen also with B. burgdorferi sensu stricto strain
B31 (Fig. 5B). Control blots incubated without HI-NHS or without
the first antibody were clear of bands (not shown).
The major C4bp-binding band of approximately 43 kDa was
shared by B. garinii g50, B. garinii g46, B. burgdorferi sensu stricto
B31 and weakly by B. burgdorferi sensu stricto N40 (Fig. 6). When
compared to B. garinii g50 sugar density gradient fractions 13 and
14, the major band was of similar size and apparently represents
the same protein.
4. Discussion
In the present report, we describe the binding of the classical
pathway inhibitor C4bp to the surface of Borrelia spirochetes, which
is a novel interaction between borrelia and the C system. The borreliae
bound C4bp from human serum with a putative receptor of
43 kDa, tentatively labeled as P43. When tested with purified C4bp
it was seen that binding was specific and sensitive to salt and heparin
indicating that it is primarily of ionic nature. C4bp maintained
its cofactor activity for factor I in the cleavage of C4b while bound
to the borrelial surface. These results thus suggest that in addition
to the previously well defined utilization of FH and FHL-1, binding
of C4bp is a novel C evasion mechanism of B. burgdorferi. Binding
of C4bp would particularly control activation of the classical and
lectin pathways of complement.
In the many disease manifestations of borreliosis, symptoms are
thought to result from the presence of spirochetes in various tissues
(Bolz and Weis, 2004). The bacteria invade joints, heart and the CNS
after hematogenous dissemination. Even in the absence of specific
antibodies, as in the early infections, the CP of C can be activated
via direct C1q binding to the target, by natural antibodies (IgM) or
by CRP during an acute phase reaction. Activation of the mannanbinding
lectin pathway has not been reported and may be unlikely
because the borrelial outer membrane does not contain mannan.
On the other hand, this pathway cold become activated by ficolins
if they bind to borrelial surfaces. Although antibody formation
against borreliae is slow, IgG antibodies are formed after bacterial
dissemination. New IgM and IgG antibodies continue to appear
after months to years in chronically ill patients and can reach relatively
high levels. Kochi and Johnson (1988) demonstrated a role
for specific IgG in classical C pathway-mediated killing of serum
resistant borrelial strains by enhanced MAC formation. However,
Brade et al. (1992) did not find differences in the bactericidal effects
of immune and nonimmune sera. Many studies, however, point
towards a protective role of immune sera against borrelial reinfection.
IgG antibodies could prevent relapses of infection by initiating
a fully bactericidal C activation. In most cases, however, activation
is controlled at the C3-amplification loop level by FH and FHL-1. The
efficiency of antibodies in activating C depends on the nature and
stability of the target antigens. The target antigens could include
also borrelial inhibitors of C, whereby killing of the bacteria would
be enhanced if the inhibitory activities are neutralized.
Relapsing fever spirochetes are able to vary their outer surface
proteins to a much greater extent than Lyme disease spirochetes.
It has been thought that because relapsing fever borreliae evade
CP by varying their variable outer surface proteins, they are able
to cause more severe infections. Multiple fever episodes and reappearances
in blood are characteristic to the disease caused by these
spirochetes until they have used all possible combinations of their
variable proteins. As we have shown recently, it is, however, possible
that relapsing fever spirochetes are unduly resistant to C
because they are able to bind also C4bp from human serum (Meri
et al., 2006).
Serum sensitivity of the different genospecies of B. burgdorferi
varies. B. burgdorferi sensu stricto and B. afzelii have in earlier studies
been found to be serum resistant, while B. garinii has in these
assays been serum sensitive (Alitalo et al., 2001; Breitner-Ruddock
et al., 1997; vanDamet al., 1997). Serum sensitivity has been shown
to correlate with the ability of the bacteria to bind the AP inhibitor
FH. B. burgdorferi sensu stricto and B. afzelii express the FH-binding
proteins OspE and Bba68/CRASP-1 (Hellwage et al., 2001; Kraiczy
et al., 2003), whereas B. garinii has in most studies been shown not
to bind FH or FHL-1. In our recent report, however, neurovirulent
B. garinii strains were found to express FH-binding proteins, but
their overall FH-binding capacity was weaker when compared to B.
afzelii and B. burgdorferi sensu stricto strains (Alitalo et al., 2005).
Depending on growth conditions, e.g. in vivo vs. in vitro, Borrelia
spirochetes seem to vary considerably the expression of their outer
surface proteins.
In this study B. garinii was found to bind more C4bp than B.
afzelii or B. burgdorferi sensu stricto (Fig. 2), although all genospecies
bound a fairly high proportion of the offered 125I-C4bp under the
conditions used. Under similar conditions, the binding of FH has
been much weaker. The difference in C4bp-binding between B.
garinii and B. afzelii genospecies was not great, but the fact that B.
garinii is a weak binder of FH/FHL-1 makes it remarkable. Limited
expression of OspE and CRASP-1/Csp-1 makes B. garinii more susceptible
to lysis by the alternative C pathway. However, later in the
course of infection at least anti-OspE antibodies develop (Panelius
et al., 2008). Analogously, antibodies may develop against putative
C4bp-binding proteins, which would limit the spread of bacteria
in the body. B. garinii causes mainly neuroborreliosis. The central
nervous system is considered to be an immunoprivileged site. It is
a good place to escape host defenses because of nonlymphatic circulation
of fluids and lesser degree of C activation. We and others
have speculated earlier that this genospecies favors CNS because
there is less AP activation and a better possibility to hide in the
cerebrospinal space. Thus, preferential binding of C4bp to B. garinii
(versus B. afzelii and B. burgdorferi sensu stricto) could compensate
for the relative lack of FH-binding proteins in B. garinii. Notably, also
N. meningitidis, another gram-negative bacterium with preference
for CNS infections, binds C4bp (Jarva et al., 2005).
B. burgdorferi sensu stricto, B. garinii and B. afzelii bound C4bp
from whole human serum (Fig. 1). C4bp bound to bacterial surface
maintained its cofactor activity for fI in cleaving C4b (Fig. 5),
suggesting that enough active sites on C4bp are available for effector
functions. The most obvious function for bound C4bp would
be down regulation of CP activation in the bacterial microenvironment.
Gram-negative bacteria, including Borreliae, are generally
lysed by MAC unless C is specifically inhibited. On the other
hand, efficient phagocytosis under nonimmune conditions requires
opsonization by C components (Underhill and Ozinsky, 2002). By
interfering with C deposition borrelia can thus evade immune
defenses more efficiently. Studies with S. pyogenes have shown
that deposition of C occurs almost exclusively via CP but C4bp
bound to bacteria limits CP activation under nonimmune conditions
(Carlsson et al., 2003). C4bp-binding is thus associated with
phagocytosis resistance by streptococci. Other possible functions
for bacteria-bound C4bp, as Johnsson et al. (1996) proposed, could
be modification of coagulation using protein S bound to the -
chain of C4bp (Dahlback, 1991) and mediation of adhesion between
bacteria and a putative receptor on human cells.
The hypervariable N-terminal region on the M-protein has
been shown to be the main receptor site for C4bp on S. pyogenes
(Johnsson et al., 1996). It binds to the SCR1-2 domains of the-chain
of C4bp in a hydrophobic manner, which also involves the C4bbinding
site (Accardo et al., 1996). S. pyogenes uses M-protein to
bind not only C4bp but also immunoglobulins, C inhibitors FH and
FHL-1, fibrinogen, fibronectin and albumin (Kotarsky et al., 1998;
Thern et al., 1995). The FH-binding proteins of B. burgdorferi, OspE
and Bba68/CRASP-1 are 15?17 kDa and ∼27 kDa, respectively. The
putative C4bp-binding protein in borrelia was found to be∼43 kDa.
This C4bp-binding receptor P43 is thus different from the known
FH-binding proteins in borrelia
In contrast to the interaction between M-protein of S. pyogenes
and C4bp, the interaction between C4bp and borrelia was found to
be sensitive to salt. Salt sensitivity points to an interaction based
on ionic forces. This seems to be the case for a number of other
bacterium?C4bp interactions as well. For example, B. pertussis, the
agent causing whooping cough, binds C4bp through filamentous
hemagglutinin using charged amino acids at the junction of the -
chain SCR1-2 domains (Berggard et al., 2001). N. gonorrhoeae uses
two porin molecules to bind C4bp. The C4bp?Por1B interaction is
sensitive to both salt and heparin, whereas the C4bp?Por1A interaction
is hydrophobic and therefore insensitive to increasing salt
concentrations (Ngampasutadol et al., 2005). We observed that the
borrelia?C4bp interaction was sensitive to heparin, which binds to
SCR1-3, SCR2 being the most important domain (Blom et al., 2001).
Therefore, the binding sites on C4bp for a putative borrelial receptor
and heparin seem to overlap to some extent. Also, C4b competed
out 125I-C4bp in binding to C4bp pointing towards a shared binding
site between the putative receptor and C4b on C4bp. C4b has
been shown to bind to SCR1-3 (Blom et al., 2001). A cluster of positively
charged amino acids at the interface between SCR1 and SCR2was found
to be most important region for this highly salt-sensitive
interaction. It should be noted that multiple -chains in C4bp allow
the use of similar binding sites simultaneously as ligand sites for
bacteria and C4b. Experimentally, this was verified as the ability of
bacteria-bound C4bp to act as cofactor for C4b cleavage.
In summary, we have demonstrated, for the first time, binding
of the C classical pathway inhibitor C4bp to all genospecies of
Lyme disease causing borreliosis and identified a putative 43 kDa
receptor (P43) for C4bp. There are only few examples of microbes,
which utilize both AP and CP inhibitors. S. pyogenes as well as N.
gonorrhoeae binds both C4bp and FH. Binding of C4bp may help
B. burgdorferi to cause chronic infections even in the presence of
specific antibodies.
Acknowledgements
We thank Marjatta Ahonen for excellent technical assistance.
This researchwassupported by theAcademyof Finland in the frame
of the ERA-NET PathoGenoMics, Sigrid Juselius Foundation, Finnish
Cultural Foundation, Maud Kuistila Foundation, Helsinki University
Central Hospital Funds (EVO) and Finska Läkaresällskapet.
References
Accardo, P., Sanchez-Corral, P., Criado, O., Garcia, E., Rodriguez de Cordoba, S., 1996.
Binding of human complement component C4b-binding protein (C4BP) to Streptococcus
pyogenes involves the C4b-binding site. J. Immunol. 157, 4935?4939.
Alitalo, A., Meri, T., Comstedt, P., Jeffery, L., Tornberg, J., Strandin, T., Lankinen, H.,
Bergstrom, S., Cinco, M., Vuppala, S.R., Akins, D.R., Meri, S., 2005. Expression
of complement factor H binding immunoevasion proteins in Borrelia garinii
isolated from patients with neuroborreliosis. Eur. J. Immunol. 35, 3043?3053.
Alitalo, A., Meri, T., Ramo, L., Jokiranta, T.S., Heikkila, T., Seppala, I.J., Oksi, J., Viljanen,
M., Meri, S., 2001. Complement evasion by Borrelia burgdorferi: serum-resistant
strains promote C3b inactivation. Infect. Immun. 69, 3685?3691.
Berggard, K., Johnsson, E., Morfeldt, E., Persson, J., Stalhammar-Carlemalm, M., Lindahl,
G., 2001. Binding of human C4BP to the hypervariable region ofMprotein:
a molecular mechanism of phagocytosis resistance in Streptococcus pyogenes.
Mol. Microbiol. 42, 539?551.
Blom, A.M., Kask, L., Dahlback, B., 2001. Structural requirements for the complement
regulatory activities of C4BP. J. Biol. Chem. 276, 27136?27144.
Blom, A.M., Villoutreix, B.O., Dahlback, B., 2004. Complement inhibitor C4bbinding
protein-friend or foe in the innate immune system? Mol. Immunol. 40,
1333?1346.
Bolz, D.D., Weis, J.J., 2004. Molecular mimicry to Borrelia burgdorferi: pathway to
autoimmunity? Autoimmunity 37, 387?392.
Brade, V., Kleber, I., Acker, G., 1992. Differences of two Borrelia burgdorferi strains
in complement activation and serum resistance. Immunobiology 185, 453?
465.
Breitner-Ruddock, S., Wurzner, R., Schulze, J., Brade, V., 1997. Heterogeneity in the
complement-dependent bacteriolysis within the species of Borrelia burgdorferi.
Med. Microbiol. Immunol. (Berl.) 185, 253?260.
Carlsson, F., Berggard, K., Stalhammar-Carlemalm, M., Lindahl, G., 2003. Evasion
of phagocytosis through cooperation between two ligand-binding regions in
Streptococcus pyogenes M protein. J. Exp. Med. 198, 1057?1068.
Dahlback, B., 1983. Purification of human C4b-binding protein and formation of its
complex with vitamin K-dependent protein S. Biochem. J. 209, 847?856.
Dahlback, B., 1991. Protein S and C4b-binding protein: components involved in the
regulation of the protein C anticoagulant system. Thromb. Haemost. 66, 49?61.
Hartmann, K., Corvey, C., Skerka, C., Kirschfink, M., Karas, M., Brade, V., Miller, J.C.,
Stevenson, B., Wallich, R., Zipfel, P.F., Kraiczy, P., 2006. Functional characterization
of BbCRASP-2, a distinct outer membrane protein of Borrelia burgdorferi
that binds host complement regulators factor H and FHL-1. Mol. Microbiol. 61,
1220?1236.
Hellwage, J., Meri, T., Heikkila, T., Alitalo, A., Panelius, J., Lahdenne, P., Seppala, I.J.,
Meri, S., 2001. The complement regulator factor H binds to the surface protein
OspE of Borrelia burgdorferi. J. Biol. Chem. 276, 8427?8435.
Jarva, H., Ram, S., Vogel, U., Blom, A.M., Meri, S., 2005. Binding of the complement
inhibitor C4bp to serogroup B Neisseria meningitidis. J. Immunol. 174,
6299?6307.
Johnsson, E., Thern, A., Dahlback, B., Heden, L.O., Wikstrom, M., Lindahl, G., 1996. A
highly variable region in members of the streptococcal M protein family binds
the human complement regulator C4BP. J. Immunol. 157, 3021?3029.
Kochi, S.K., Johnson, R.C., 1988. Role of immunoglobulin G in killing of Borrelia
burgdorferi by the classical complement pathway. Infect. Immun. 56, 314?321.
Kotarsky, H., Hellwage, J., Johnsson, E., Skerka, C., Svensson, H.G., Lindahl, G., Sjobring,
U., Zipfel, P.F., 1998. Identification of a domain in human factor H and
factor H-like protein-1 required for the interaction with streptococcal M proteins.
J. Immunol. 160, 3349?3354.
Kraiczy, P., Hellwage, J., Skerka, C., Becker, H., Kirschfink, M., Simon, M.M., Brade,
V., Zipfel, P.F., Wallich, R., 2004. Complement resistance of Borrelia burgdorferi
correlates with the expression of BbCRASP-1, a novel linear plasmid-encoded
surface protein that interacts with human factor H and FHL-1 and is unrelated
to Erp proteins. J. Biol. Chem. 279, 2421?2429.
Kraiczy, P., Hellwage, J., Skerka, C., Kirschfink, M., Brade, V., Zipfel, P.F., Wallich,
R., 2003. Immune evasion of Borrelia burgdorferi: mapping of a complementinhibitor
factor H-binding site of BbCRASP-3, a novel member of the Erp protein
family. Eur. J. Immunol. 33, 697?707.
Lambris, J.D., Ricklin, D., Geisbrecht, B.V., 2008. Complement evasion by human
pathogens. Nat. Rev. Microbiol. 6, 132?142.
Meri, T., Cutler, S.J., Blom, A.M., Meri, S., Jokiranta, T.S., 2006. Relapsing fever
spirochetes Borrelia recurrentis and B. duttonii acquire complement regulators
C4b-binding protein and factor H. Infect. Immun. 74, 4157?4163.
Ngampasutadol, J., Ram, S., Blom, A.M., Jarva, H., Jerse, A.E., Lien, E., Goguen, J., Gulati,
S., Rice, P.A., 2005. Human C4b-binding protein selectively interacts with Neisseria
gonorrhoeae and results in species-specific infection. Proc. Natl. Acad. Sci.
U.S.A. 102, 17142?17147.
Panelius, J., Meri, T., Seppala, I., Eholuoto, M., Alitalo, A., Meri, S., 2008. Outer surface
protein E antibody response and its effect on complement factor H binding to
OspE in Lyme borreliosis. Microbes Infect. 10, 135?142.
Radolf, J.D., Goldberg, M.S., Bourell, K., Baker, S.I., Jones, J.D., Norgard, M.V., 1995.
Characterization of outer membranes isolated from Borrelia burgdorferi, the
Lyme disease spirochete. Infect. Immun. 63, 2154?2163.
Salacinski, P.R., McLean, C., Sykes, J.E., Clement-Jones, V.V., Lowry, P.J., 1981. Iodination
of proteins, glycoproteins, and peptides using a solid-phase oxidizing
agent, 1,3,4,6-tetrachloro-3 alpha,6 alpha-diphenyl glycoluril (Iodogen). Anal.
Biochem. 117, 136?146.
Steere, A.C., 1989. Lyme disease. N. Engl. J. Med. 321, 586?596.
Thern, A., Stenberg, L., Dahlback, B., Lindahl, G., 1995. Ig-binding surface proteins of
Streptococcus pyogenes also bind human C4b-binding protein (C4BP), a regulatory
component of the complement system. J. Immunol. 154, 375?386.
Underhill, D.M., Ozinsky, A., 2002. Phagocytosis of microbes: complexity in action.
Annu. Rev. Immunol. 20, 825?852.
van Dam, A.P., Oei, A., Jaspars, R., Fijen, C., Wilske, B., Spanjaard, L., Dankert, J., 1997.
Complement-mediated serum sensitivity among spirochetes that cause Lyme
disease. Infect. Immun. 65, 1228?1236.
Neuroborrelioosin hoidon jälkeen useilla potilailla, jopa 50 %:lla, esiintyy edelleen oireita. Potilaita seurattiin oireiden alkamisesta 6 - 142 kk. (2010)
Tjernberg, I., Carlsson, M., Ernerudh, J., Eliasson, I., and Forsberg, P. (2010).
Mapping of hormones and cortisol responses in patients after Lyme neuroborreliosis [Electronic version]. BMC Infectious Diseases 10(20). Retrieved February 12, 2010 from http://www.biomedcentral.com/content/pd ... -10-20.pdf
"Residual symptoms after treatment of LNB are common and have been reported by some 25-
50% of patients 6-142 months after onset of neurological symptoms [3-5]." (p. 3)
Tjernberg, I., Carlsson, M., Ernerudh, J., Eliasson, I., and Forsberg, P. (2010).
Mapping of hormones and cortisol responses in patients after Lyme neuroborreliosis [Electronic version]. BMC Infectious Diseases 10(20). Retrieved February 12, 2010 from http://www.biomedcentral.com/content/pd ... -10-20.pdf
"Residual symptoms after treatment of LNB are common and have been reported by some 25-
50% of patients 6-142 months after onset of neurological symptoms [3-5]." (p. 3)
Useilla eurooppalaisilla on B. gariniin aiheutttama borrelioosi. Jälleen uusi tutkimus jossa esim. kyseisen bakteerin todettiin pystyvän pakenemaan immuunipuolustusta. (2010)
Identification and functional characterisation of Complement Regulator Acquiring Surface Protein-1 of serum resistant Borrelia garinii OspA serotype 4
Nathalie D van Burgel1 email, Peter Kraiczy2 email, Tim J Schuijt1 email, Peter F Zipfel3 email and Alje P van Dam1 email
1 Department of Medical Microbiology, Centre of Infectious Diseases, Leiden University Medical Centre, PO Box 9600, 2300 RC, Leiden, the Netherlands
2 Institute of Medical Microbiology and Infection Control, University Hospital of Frankfurt, Paul-Ehrlich-Str. 40, D-60596 Frankfurt, Germany
3 Department of Infection Biology, Leibniz-Institute for Natural Products Research, Beutenbergstr.11a, 07745 Jena, Germany
author email corresponding author email
BMC Microbiology 2010, 10:43doi:10.1186/1471-2180-10-43
Published: 10 February 2010
Abstract
Background
B. burgdorferi sensu lato (sl) is the etiological agent of Lyme borreliosis in humans. Spirochetes have adapted themselves to the human immune system in many distinct ways. One important immune escape mechanism for evading complement activation is the binding of complement regulators Factor H (CFH) or Factor H-like protein1 (FHL-1) to Complement Regulator-Acquiring Surface Proteins (CRASPs).
Results
We demonstrate that B. garinii OspA serotype 4 (ST4) PBi resist complement-mediated killing by binding of FHL-1. To identify the primary ligands of FHL-1 four CspA orthologs from B. garinii ST4 PBi were cloned and tested for binding to human CFH and FHL-1. Orthologs BGA66 and BGA71 were found to be able to bind both complement regulators but with different intensities. In addition, all CspA orthologs were tested for binding to mammalian and avian CFH. Distinct orthologs were able to bind to CFH of different animal origins.
Conclusions
B. garinii ST4 PBi is able to evade complement killing and it can bind FHL-1 to membrane expressed proteins. Recombinant proteins BGA66 can bind FHL-1 and human CFH, while BGA71 can bind only FHL-1. All recombinant CspA orthologs from B. garinii ST4 PBi can bind CFH from different animal origins. This partly explains the wide variety of animals that can be infected by B. garinii.
Identification and functional characterisation of Complement Regulator Acquiring Surface Protein-1 of serum resistant Borrelia garinii OspA serotype 4
Nathalie D van Burgel1 email, Peter Kraiczy2 email, Tim J Schuijt1 email, Peter F Zipfel3 email and Alje P van Dam1 email
1 Department of Medical Microbiology, Centre of Infectious Diseases, Leiden University Medical Centre, PO Box 9600, 2300 RC, Leiden, the Netherlands
2 Institute of Medical Microbiology and Infection Control, University Hospital of Frankfurt, Paul-Ehrlich-Str. 40, D-60596 Frankfurt, Germany
3 Department of Infection Biology, Leibniz-Institute for Natural Products Research, Beutenbergstr.11a, 07745 Jena, Germany
author email corresponding author email
BMC Microbiology 2010, 10:43doi:10.1186/1471-2180-10-43
Published: 10 February 2010
Abstract
Background
B. burgdorferi sensu lato (sl) is the etiological agent of Lyme borreliosis in humans. Spirochetes have adapted themselves to the human immune system in many distinct ways. One important immune escape mechanism for evading complement activation is the binding of complement regulators Factor H (CFH) or Factor H-like protein1 (FHL-1) to Complement Regulator-Acquiring Surface Proteins (CRASPs).
Results
We demonstrate that B. garinii OspA serotype 4 (ST4) PBi resist complement-mediated killing by binding of FHL-1. To identify the primary ligands of FHL-1 four CspA orthologs from B. garinii ST4 PBi were cloned and tested for binding to human CFH and FHL-1. Orthologs BGA66 and BGA71 were found to be able to bind both complement regulators but with different intensities. In addition, all CspA orthologs were tested for binding to mammalian and avian CFH. Distinct orthologs were able to bind to CFH of different animal origins.
Conclusions
B. garinii ST4 PBi is able to evade complement killing and it can bind FHL-1 to membrane expressed proteins. Recombinant proteins BGA66 can bind FHL-1 and human CFH, while BGA71 can bind only FHL-1. All recombinant CspA orthologs from B. garinii ST4 PBi can bind CFH from different animal origins. This partly explains the wide variety of animals that can be infected by B. garinii.
Borreliabakteerit voivat selvitä elimistössä vuosikausia kystamuodossa (pyöreä muoto). Siinä muodossa ne selviävät paremmin erilaisista uhista kuten antibiooteista. Uusi antibiootti "Tigesykliini" saattaa olla aiempia antibiootteja tehokkaampaa.
http://www.umass.edu/loop/talkingpoints ... /99534.php
Margulis and colleagues spirochete research may point to new Lyme treatment
[] In Proceedings of the National Academy of Sciences, Distinguished Professor Lynn Margulis, Geosciences, UMass Amherst advanced and former students James MacAllister and Andrew Wier and their colleagues in Norway and Canada, report new details about the life history of the spirochete bacterium, Borelia burgdorferi, which causes Lyme disease. Their study leads them to suggest that clinical trials of the antibiotic Tigecycline are warranted. This drug potentially provides a treatment regimen for people with Lyme disease that has worked, so far only in the laboratory, to destroy spirochetes, they point out.
The study represents a lifetime of work by medical microbiologist Oystein Brorson and his pathologist cousin, Sverre-Henning Brorson of Oslo, Norway, says Margulis, a winner of the Darwin and Wallace Medal from the Linnean Society of London. She recently returned to campus from a year as Eastman Professor at Balliol College, Oxford University.
B. burgdorferi spirochetes take up residence in tissues of people bitten by ticks that carry the bacteria in their guts and inject them via saliva. The spirochetes most familiar form is an agile, spiral-shaped swimmer associated with acute symptoms of Lyme disease and rapid reproduction of the bacteria. But as Margulis explains, these bacteria can go underground and persist for years by entering a self-protective, quiescent stage known as a spirochete round-body (RB) propagule. In this state, they better resist what scientists call unfavorable environmental conditions such as starvation, desiccation and exposure to antibiotics such as penicillin and deoxycillin. Chronic Lyme disease symptoms correlate with the continuous presence of reversible RB propagules in patients moist tissues.
What the Brorsons work shows is that, unlike other antibiotics, Tygecycline administered at the correct dosage and timing destroys the bacterium even when it has protected itself in this quiescent stage. Other antibiotics, if they do anything at all, simply cause B. burgdorferi to enter its RB propagule state and wait out the treatment. â??Tigecycline is, so far, the only known antibiotic that destroys the Lyme disease spirochete in both the growing and the quiescent RB stages of its life historyâ? Margulis notes.
She and her students are interested in spirochetes, in particular two individuals found embedded in ancient (15 million-year-old) amber and their RB propagules, because of the Serial Endosymbiosis Theory of the evolution of nucleated cells. It posits that animal, plant, fungal and other cells with nuclei evolved by symbiotic merger of two types of bacteria, at least: A spirochete (belonging to the eubacterium group) that reversibly develops RB propagules in response to changing conditions, and Thermoplasma, from the archaebacterium group, a sulfide-gas-making microbe that lives in nearly boiling and very acidic waters (more acid than our stomachs). In their PNAS paper, the authors state that chronic spirochete infections in humans when seen in their ecological-evolutionary context are examples of symbioses that have evolved over geologic time.
Image: Persistent quiescent Lyme disease spirochete (Borrelia burgdorferi) round bodies (RBs) may endure for years. They stain red as seen with here with a fluorescence microscope (scale bar = 8 micrometers). One RB is seen at very high magnification with an electron microscope (EM) thin section in the lower left inset). After incubation in a favorable supportive blood serum growth medium for over one month the RBs develop into normal helical swimmer spirochetes as seen in the EM photo of the upper right inset (bar = 1 micrometer). (Photo courtesy of Oystein and Sverre-Henning Brorson)
February 17, 2010.
http://www.umass.edu/loop/talkingpoints ... /99534.php
Margulis and colleagues spirochete research may point to new Lyme treatment
[] In Proceedings of the National Academy of Sciences, Distinguished Professor Lynn Margulis, Geosciences, UMass Amherst advanced and former students James MacAllister and Andrew Wier and their colleagues in Norway and Canada, report new details about the life history of the spirochete bacterium, Borelia burgdorferi, which causes Lyme disease. Their study leads them to suggest that clinical trials of the antibiotic Tigecycline are warranted. This drug potentially provides a treatment regimen for people with Lyme disease that has worked, so far only in the laboratory, to destroy spirochetes, they point out.
The study represents a lifetime of work by medical microbiologist Oystein Brorson and his pathologist cousin, Sverre-Henning Brorson of Oslo, Norway, says Margulis, a winner of the Darwin and Wallace Medal from the Linnean Society of London. She recently returned to campus from a year as Eastman Professor at Balliol College, Oxford University.
B. burgdorferi spirochetes take up residence in tissues of people bitten by ticks that carry the bacteria in their guts and inject them via saliva. The spirochetes most familiar form is an agile, spiral-shaped swimmer associated with acute symptoms of Lyme disease and rapid reproduction of the bacteria. But as Margulis explains, these bacteria can go underground and persist for years by entering a self-protective, quiescent stage known as a spirochete round-body (RB) propagule. In this state, they better resist what scientists call unfavorable environmental conditions such as starvation, desiccation and exposure to antibiotics such as penicillin and deoxycillin. Chronic Lyme disease symptoms correlate with the continuous presence of reversible RB propagules in patients moist tissues.
What the Brorsons work shows is that, unlike other antibiotics, Tygecycline administered at the correct dosage and timing destroys the bacterium even when it has protected itself in this quiescent stage. Other antibiotics, if they do anything at all, simply cause B. burgdorferi to enter its RB propagule state and wait out the treatment. â??Tigecycline is, so far, the only known antibiotic that destroys the Lyme disease spirochete in both the growing and the quiescent RB stages of its life historyâ? Margulis notes.
She and her students are interested in spirochetes, in particular two individuals found embedded in ancient (15 million-year-old) amber and their RB propagules, because of the Serial Endosymbiosis Theory of the evolution of nucleated cells. It posits that animal, plant, fungal and other cells with nuclei evolved by symbiotic merger of two types of bacteria, at least: A spirochete (belonging to the eubacterium group) that reversibly develops RB propagules in response to changing conditions, and Thermoplasma, from the archaebacterium group, a sulfide-gas-making microbe that lives in nearly boiling and very acidic waters (more acid than our stomachs). In their PNAS paper, the authors state that chronic spirochete infections in humans when seen in their ecological-evolutionary context are examples of symbioses that have evolved over geologic time.
Image: Persistent quiescent Lyme disease spirochete (Borrelia burgdorferi) round bodies (RBs) may endure for years. They stain red as seen with here with a fluorescence microscope (scale bar = 8 micrometers). One RB is seen at very high magnification with an electron microscope (EM) thin section in the lower left inset). After incubation in a favorable supportive blood serum growth medium for over one month the RBs develop into normal helical swimmer spirochetes as seen in the EM photo of the upper right inset (bar = 1 micrometer). (Photo courtesy of Oystein and Sverre-Henning Brorson)
February 17, 2010.
Vaihdevuosissa olevilla naisilla saattaa olla suurempi riski sairastua borrelioosiin. Heillä on miehistä poikkeava immuunireaktio; korkeampi IL-4: IFN-gamma ja IL-10: TNF-alpha. Tulos viittaa siihen että naisilla on Th2 -suuntautunut immuunivaste joka heikentää elimistön mahdollisuuksia eliminoida spirokeettoja. (Ruotsi 2006)
http://www.ncbi.nlm.nih.gov/pubmed/1677 ... d_RVDocSum
Lynn Shepler MD JD
Immunology. 2006 Jun;118(2):224-32. Links
Lyme borreliosis reinfection: might it be explained by a gender difference in immune response?
Jarefors S, Bennet L, You E, Forsberg P, Ekerfelt C, Berglund J, Ernerudh J.
Division of Clinical Immunology, University of Linköping, Linköping, Sweden. sarja@imk.liu.se
Lyme borreliosis is a tick-borne disease often manifesting as a circular skin lesion. This cutaneous form of the disease is known as erythema migrans. In a 5-year follow-up study in southern Sweden, 31 of 708 individuals initially diagnosed with erythema migrans and treated with antibiotics were found to be reinfected with Borrelia burgdorferi. Although men and women were tick-bitten to the same extent, 27 of the 31 reinfected individuals were women, all of whom were over 44 years of age. The aim of this study was to determine whether this discrepancy in gender distribution could be a result of differences in immunological response. Twenty single-infected and 21 reinfected women and 18 single-infected and three reinfected men were included in the study. None of the participants showed any sign of an ongoing B. burgdorferi infection, and thus the habitual response was captured. Lymphocytes were separated from blood and stimulated with antigens. The secretion of interleukin (IL)-4, IL-6, IL-10, interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha was measured by enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent spot-forming cell assay (ELISPOT) or Immulite. No difference was detected in cytokine secretion between single-infected and reinfected individuals. We also compared the immunological response in men and women, regardless of the number of B. burgdorferi infections. Women displayed a significantly higher spontaneous secretion of all cytokines measured. The ratios of IL-4:IFN-gamma and IL-10:TNF-alpha were significantly higher in women. Gender differences in immune reactivity might in part explain the higher incidence of reinfection in women. The higher IL-4:IFN-gamma and IL-10:TNF-alpha ratios seen in women indicate that postmenopausal women have T helper type 2 (Th2)-directed reactivity with impaired inflammatory responses which might inhibit the elimination of spirochetes.
http://www.ncbi.nlm.nih.gov/pubmed/1677 ... d_RVDocSum
Lynn Shepler MD JD
Immunology. 2006 Jun;118(2):224-32. Links
Lyme borreliosis reinfection: might it be explained by a gender difference in immune response?
Jarefors S, Bennet L, You E, Forsberg P, Ekerfelt C, Berglund J, Ernerudh J.
Division of Clinical Immunology, University of Linköping, Linköping, Sweden. sarja@imk.liu.se
Lyme borreliosis is a tick-borne disease often manifesting as a circular skin lesion. This cutaneous form of the disease is known as erythema migrans. In a 5-year follow-up study in southern Sweden, 31 of 708 individuals initially diagnosed with erythema migrans and treated with antibiotics were found to be reinfected with Borrelia burgdorferi. Although men and women were tick-bitten to the same extent, 27 of the 31 reinfected individuals were women, all of whom were over 44 years of age. The aim of this study was to determine whether this discrepancy in gender distribution could be a result of differences in immunological response. Twenty single-infected and 21 reinfected women and 18 single-infected and three reinfected men were included in the study. None of the participants showed any sign of an ongoing B. burgdorferi infection, and thus the habitual response was captured. Lymphocytes were separated from blood and stimulated with antigens. The secretion of interleukin (IL)-4, IL-6, IL-10, interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha was measured by enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunosorbent spot-forming cell assay (ELISPOT) or Immulite. No difference was detected in cytokine secretion between single-infected and reinfected individuals. We also compared the immunological response in men and women, regardless of the number of B. burgdorferi infections. Women displayed a significantly higher spontaneous secretion of all cytokines measured. The ratios of IL-4:IFN-gamma and IL-10:TNF-alpha were significantly higher in women. Gender differences in immune reactivity might in part explain the higher incidence of reinfection in women. The higher IL-4:IFN-gamma and IL-10:TNF-alpha ratios seen in women indicate that postmenopausal women have T helper type 2 (Th2)-directed reactivity with impaired inflammatory responses which might inhibit the elimination of spirochetes.
Krooninen niveltulehdus: Tutkimuksen mukaan regulatoristen auttajasolujen (T-solut) määrä on vähäinen hoitoon huonosti reagoivissa borrelia-bakteerin aiheuttamissa niveltulehdustapauksissa . (2010)
Arthritis Rheum. 2010 Mar 26; [Epub ahead of print]
T regulatory cell numbers and function in patients with antibiotic-refractory or
antibiotic-responsive lyme arthritis.
Shen S, Shin JJ, Strle K, McHugh G, Li X, Glickstein LJ, Drouin EE, Steere AC.
Harvard Medical School and Massachusetts General Hospital, Boston,
Massachusetts.
OBJECTIVE.: In a murine model of antibiotic-refractory Lyme arthritis, the
numbers of T regulatory cells (Treg) are dramatically reduced. Our goal was to
examine Treg numbers and function in human patients with antibiotic-refractory
Lyme arthritis. METHODS.: CD4+ T cell subsets were enumerated in peripheral
blood (PB) and synovial fluid (SF) in 12 patients with antibiotic-refractory
arthritis and 6 with antibiotic-responsive arthritis. Treg function was examined
using Borrelia-specific and non-specific Treg proliferation assays. RESULTS.: In
both patient groups, IFN-gamma+ T(H)1 cells in SF were abundant and enriched (
approximately 50% of CD4+ T cells). In patients with antibiotic-refractory
arthritis, the median percentages of FoxP3+ Treg were significantly higher in SF
than PB (12% versus 6%) (P<0.01) or in SF in patients with antibiotic-responsive
arthritis (12% versus 5%) (P=0.04). Moreover, in the refractory group, a higher
percentage of Treg in SF correlated with a shorter duration to resolution of
arthritis (r = -0.74, P = 0.006). In contrast, patients with fewer Treg had
suboptimal responses to DMARDs and longer duration of arthritis after
antibiotics, and they often required synovectomies for arthritis resolution. In
each group, Treg in SF dampened B. burgdorferi-specific proliferative responses,
and in 2 patients with refractory arthritis, Treg were functional in
non-specific suppression assays.
CONCLUSIONS.: Treg were functional in patients with antibiotic-refractory arthritis, and in some patients, higher numbers of
these cells in SF appeared to participate in arthritis resolution.
However, as in the murine model, patients with refractory arthritis and lower numbers of Treg seemed unable to resolve synovial inflammation.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20506317 [PubMed - as supplied by publisher]
Arthritis Rheum. 2010 Mar 26; [Epub ahead of print]
T regulatory cell numbers and function in patients with antibiotic-refractory or
antibiotic-responsive lyme arthritis.
Shen S, Shin JJ, Strle K, McHugh G, Li X, Glickstein LJ, Drouin EE, Steere AC.
Harvard Medical School and Massachusetts General Hospital, Boston,
Massachusetts.
OBJECTIVE.: In a murine model of antibiotic-refractory Lyme arthritis, the
numbers of T regulatory cells (Treg) are dramatically reduced. Our goal was to
examine Treg numbers and function in human patients with antibiotic-refractory
Lyme arthritis. METHODS.: CD4+ T cell subsets were enumerated in peripheral
blood (PB) and synovial fluid (SF) in 12 patients with antibiotic-refractory
arthritis and 6 with antibiotic-responsive arthritis. Treg function was examined
using Borrelia-specific and non-specific Treg proliferation assays. RESULTS.: In
both patient groups, IFN-gamma+ T(H)1 cells in SF were abundant and enriched (
approximately 50% of CD4+ T cells). In patients with antibiotic-refractory
arthritis, the median percentages of FoxP3+ Treg were significantly higher in SF
than PB (12% versus 6%) (P<0.01) or in SF in patients with antibiotic-responsive
arthritis (12% versus 5%) (P=0.04). Moreover, in the refractory group, a higher
percentage of Treg in SF correlated with a shorter duration to resolution of
arthritis (r = -0.74, P = 0.006). In contrast, patients with fewer Treg had
suboptimal responses to DMARDs and longer duration of arthritis after
antibiotics, and they often required synovectomies for arthritis resolution. In
each group, Treg in SF dampened B. burgdorferi-specific proliferative responses,
and in 2 patients with refractory arthritis, Treg were functional in
non-specific suppression assays.
CONCLUSIONS.: Treg were functional in patients with antibiotic-refractory arthritis, and in some patients, higher numbers of
these cells in SF appeared to participate in arthritis resolution.
However, as in the murine model, patients with refractory arthritis and lower numbers of Treg seemed unable to resolve synovial inflammation.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20506317 [PubMed - as supplied by publisher]
Suomalaiset tutkijat totesivat toistamiseen borrelia-bakteerin selviytyvän elimistössä antibioottihoidoista huolimatta. Bakteeria löydettiin 30 - 100%:lta hoitoa saaneiden hiirien nivelistä tai niveliä lähellä olevista kudoksista. Antibioottina käytettiin keftriaksonia, joka on sama antibiootti jota Suomessa käytetään taudin myöhäisvaiheessa suonensisäisenä hoitona. Nyt tukimuksessa siis toistamiseen todettiin bakteerin elävän elimistössä hoidosta huolimatta. (2010. Yrjänäinen, Hytönen, Hartiala, Oksi, Viljanen)
"Importantly, B.burgdorferi DNA was detected in the joints of 30-100% of the treated mice. In conclusion, these results combined with earlier results suggest that the joint or a tissue adjacent to the joint is the niche of persisting B. burgdorferi in
ceftriaxone-treated mice.
APMIS. 2010 Sep 1;118(9):665-73.
Persistence of borrelial DNA in the joints of Borrelia burgdorferi-infected mice
after ceftriaxone treatment.
Yrjanainen H, Hytonen J, Hartiala P, Oksi J, Viljanen MK.
Departments of Medical Microbiology and Immunology, University of Turku, Turku,
Finland.
We have earlier shown that
Borrelia burgdorferi-infected and ceftriaxone-treated mice have viable
spirochetes in their body, since immunosuppressive treatment allows B.
burgdorferi to be detected by culture. However, the niche of the persisting
spirochetes remained unknown. In the present study, we analyzed the tissues of
B. burgdorferi-infected and ceftriaxone-treated mice by culture and PCR to
reveal the foci of persisting spirochetes. C3H/HeN mice were infected via
intradermal needle injection with B. burgdorferi s.s. N40. The mice were treated
as follows: (i) short (5 days) and (ii) long (18 days) course of ceftriaxone at
2 weeks of infection and killed after either 10 or 30 weeks, or (iii) the mice
received ceftriaxone for 5 days at 18 weeks of infection and were killed 21
weeks after the treatment. All samples of ceftriaxone-treated mice were culture
negative, whereas all untreated controls were culture positive. Importantly, B.
burgdorferi DNA was detected in the joints of 30-100% of the treated mice. In
conclusion, these results combined with earlier results suggest that the joint
or a tissue adjacent to the joint is the niche of persisting B. burgdorferi in
ceftriaxone-treated mice.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20718718 [PubMed - in process]
"Importantly, B.burgdorferi DNA was detected in the joints of 30-100% of the treated mice. In conclusion, these results combined with earlier results suggest that the joint or a tissue adjacent to the joint is the niche of persisting B. burgdorferi in
ceftriaxone-treated mice.
APMIS. 2010 Sep 1;118(9):665-73.
Persistence of borrelial DNA in the joints of Borrelia burgdorferi-infected mice
after ceftriaxone treatment.
Yrjanainen H, Hytonen J, Hartiala P, Oksi J, Viljanen MK.
Departments of Medical Microbiology and Immunology, University of Turku, Turku,
Finland.
We have earlier shown that
Borrelia burgdorferi-infected and ceftriaxone-treated mice have viable
spirochetes in their body, since immunosuppressive treatment allows B.
burgdorferi to be detected by culture. However, the niche of the persisting
spirochetes remained unknown. In the present study, we analyzed the tissues of
B. burgdorferi-infected and ceftriaxone-treated mice by culture and PCR to
reveal the foci of persisting spirochetes. C3H/HeN mice were infected via
intradermal needle injection with B. burgdorferi s.s. N40. The mice were treated
as follows: (i) short (5 days) and (ii) long (18 days) course of ceftriaxone at
2 weeks of infection and killed after either 10 or 30 weeks, or (iii) the mice
received ceftriaxone for 5 days at 18 weeks of infection and were killed 21
weeks after the treatment. All samples of ceftriaxone-treated mice were culture
negative, whereas all untreated controls were culture positive. Importantly, B.
burgdorferi DNA was detected in the joints of 30-100% of the treated mice. In
conclusion, these results combined with earlier results suggest that the joint
or a tissue adjacent to the joint is the niche of persisting B. burgdorferi in
ceftriaxone-treated mice.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20718718 [PubMed - in process]
Kroonista Borrelioosia sairastavilla esiintyi poikkeava immuunivaste (2010)
Suom.huom. Kirjoittajien joukosta löytyy myös IDSA:n Wormser ja Klempner.
Anti-neural antibody reactivity in patients with a history of Lyme borreliosis and persistent symptoms.
Chandra A, Wormser GP, Klempner MS, Trevino RP, Crow MK, Latov N, Alaedini A.
Department of Neurology and Neuroscience, Cornell University, New York, NY 10065, USA.
Comment in:
* Brain Behav Immun. 2010 Aug;24(6):1025; author reply 1026.
* Brain Behav Immun. 2010 Aug;24(6):1027; author reply 1028.
Abstract
Some Lyme disease patients report debilitating chronic symptoms of pain, fatigue, and cognitive deficits despite recommended courses of antibiotic treatment. The mechanisms responsible for these symptoms, collectively referred to as post-Lyme disease syndrome (PLS) or chronic Lyme disease, remain unclear. We investigated the presence of immune system abnormalities in PLS by assessing the levels of antibodies to neural proteins in patients and controls. Serum samples from PLS patients, post-Lyme disease healthy individuals, patients with systemic lupus erythematosus, and normal healthy individuals were analyzed for anti-neural antibodies by immunoblotting and immunohistochemistry. Anti-neural antibody reactivity was found to be significantly higher in the PLS group than in the post-Lyme healthy (p<0.01) and normal healthy (p<0.01) groups. The observed heightened antibody reactivity in PLS patients could not be attributed solely to the presence of cross-reactive anti-borrelia antibodies, as the borrelial seronegative patients also exhibited elevated anti-neural antibody levels. Immunohistochemical analysis of PLS serum antibody activity demonstrated binding to cells in the central and peripheral nervous systems.
The results provide evidence for the existence of a differential immune system response in PLS, offering new clues about the etiopathogenesis of the disease that may prove useful in devising more effective treatment strategies. Copyright 2010 Elsevier Inc. All rights reserved.
PMID: 20227484 [PubMed - in process]PMCID: PMC2897967 [Available on 2011/8/1]
Suom.huom. Kirjoittajien joukosta löytyy myös IDSA:n Wormser ja Klempner.
Anti-neural antibody reactivity in patients with a history of Lyme borreliosis and persistent symptoms.
Chandra A, Wormser GP, Klempner MS, Trevino RP, Crow MK, Latov N, Alaedini A.
Department of Neurology and Neuroscience, Cornell University, New York, NY 10065, USA.
Comment in:
* Brain Behav Immun. 2010 Aug;24(6):1025; author reply 1026.
* Brain Behav Immun. 2010 Aug;24(6):1027; author reply 1028.
Abstract
Some Lyme disease patients report debilitating chronic symptoms of pain, fatigue, and cognitive deficits despite recommended courses of antibiotic treatment. The mechanisms responsible for these symptoms, collectively referred to as post-Lyme disease syndrome (PLS) or chronic Lyme disease, remain unclear. We investigated the presence of immune system abnormalities in PLS by assessing the levels of antibodies to neural proteins in patients and controls. Serum samples from PLS patients, post-Lyme disease healthy individuals, patients with systemic lupus erythematosus, and normal healthy individuals were analyzed for anti-neural antibodies by immunoblotting and immunohistochemistry. Anti-neural antibody reactivity was found to be significantly higher in the PLS group than in the post-Lyme healthy (p<0.01) and normal healthy (p<0.01) groups. The observed heightened antibody reactivity in PLS patients could not be attributed solely to the presence of cross-reactive anti-borrelia antibodies, as the borrelial seronegative patients also exhibited elevated anti-neural antibody levels. Immunohistochemical analysis of PLS serum antibody activity demonstrated binding to cells in the central and peripheral nervous systems.
The results provide evidence for the existence of a differential immune system response in PLS, offering new clues about the etiopathogenesis of the disease that may prove useful in devising more effective treatment strategies. Copyright 2010 Elsevier Inc. All rights reserved.
PMID: 20227484 [PubMed - in process]PMCID: PMC2897967 [Available on 2011/8/1]
Borrelia-bakteeri stimuloi elimistön monosyyttejä ja makrofageja sekä suoraan että epäsuoraan ja ohjaa siten immuunipuolustuksen toimintaa. Asia havaittiin niveltulehduksesta kärsivillä Borrelioosi-potilailla. Näytteet otettiin nivelnesteestä. (2010)
Arthritis Res Ther. 2010 Sep 9;12(5):R168 [Epub ahead of print]
Borrelia burgdorferi stimulation of chemokine secretion by cells of monocyte
lineage in patients with Lyme arthritis.
Shin JJ, Strle K, Glickstein GJ, Luster AD, Steere AC.
ABSTRACT: INTRODUCTION: Joint fluid in patients with Lyme arthritis often
contains high levels of CCL4 and CCL2, which are chemoattractants for monocytes
and some T cells, and CXCL9 and CXCL10, which are chemoattractants for CD4+ and
CD8+ T effector cells. These chemokines are produced primarily by cells of
monocyte lineage in TH1-type immune responses. Our goal was to begin to learn
how infection with Borrelia burgdorferi leads to the secretion of these
chemokines, using patient cell samples. We hypothesized that B. burgdorferi
stimulates chemokine secretion from monocytes/ macrophages in multiple ways,
thereby linking innate and adaptive immune responses.
METHODS: Peripheral blood
mononuclear cells (PBMC) from 24 Lyme arthritis patients were stimulated with B.
burgdorferi, interferon (IFN)-gamma, or both, and the levels of CCL4, CCL2,
CXCL9 and CXCL10 were measured in culture supernatants. CD14+
monocytes/macrophages from PBMC and synovial fluid mononuclear cells (SFMC) were
stimulated in the same way, using available samples. CXCR3, the receptor for
CXCL9 and CXCL10, and CCR5, the receptor for CCL4, were assessed on T cells from
PBMC and SFMC.
RESULTS: In patients with Lyme arthritis, B. burgdorferi but not
IFN-gamma induced PBMC to secrete CCL4 and CCL2, and B. burgdorferi and
IFN-gamma each stimulated the production of CXCL9 and CXCL10. However, with the
CD14+ cell fraction, B. burgdorferi alone stimulated the secretion of CCL4; B.
burgdorferi and IFN-gamma together induced CCL2 secretion, and IFN-gamma alone
stimulated the secretion of CXCL9 and CXCL10. The percentage of T cells
expressing CXCR3 or CCR5 was significantly greater in SFMC than PBMC, confirming
that TH1 effector cells were recruited to inflamed joints. However, when
stimulated with B. burgdorferi or IFN-gamma, SFMC and PBMC responded similarly.
CONCLUSIONS: B. burgdorferi stimulates PBMC or CD14+ monocytes/macrophages
directly to secrete CCL4, but spirochetal stimulation of other intermediate
cells, which are present in PBMC, is required to induce CD14+ cells to secrete
CCL2, CXCL9 and CXCL10. We conclude that B. burgdorferi stimulates
monocytes/macrophages directly and indirectly to guide innate and adaptive
immune responses in patients with Lyme arthritis.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20828409 [PubMed - as supplied by publisher]
Arthritis Res Ther. 2010 Sep 9;12(5):R168 [Epub ahead of print]
Borrelia burgdorferi stimulation of chemokine secretion by cells of monocyte
lineage in patients with Lyme arthritis.
Shin JJ, Strle K, Glickstein GJ, Luster AD, Steere AC.
ABSTRACT: INTRODUCTION: Joint fluid in patients with Lyme arthritis often
contains high levels of CCL4 and CCL2, which are chemoattractants for monocytes
and some T cells, and CXCL9 and CXCL10, which are chemoattractants for CD4+ and
CD8+ T effector cells. These chemokines are produced primarily by cells of
monocyte lineage in TH1-type immune responses. Our goal was to begin to learn
how infection with Borrelia burgdorferi leads to the secretion of these
chemokines, using patient cell samples. We hypothesized that B. burgdorferi
stimulates chemokine secretion from monocytes/ macrophages in multiple ways,
thereby linking innate and adaptive immune responses.
METHODS: Peripheral blood
mononuclear cells (PBMC) from 24 Lyme arthritis patients were stimulated with B.
burgdorferi, interferon (IFN)-gamma, or both, and the levels of CCL4, CCL2,
CXCL9 and CXCL10 were measured in culture supernatants. CD14+
monocytes/macrophages from PBMC and synovial fluid mononuclear cells (SFMC) were
stimulated in the same way, using available samples. CXCR3, the receptor for
CXCL9 and CXCL10, and CCR5, the receptor for CCL4, were assessed on T cells from
PBMC and SFMC.
RESULTS: In patients with Lyme arthritis, B. burgdorferi but not
IFN-gamma induced PBMC to secrete CCL4 and CCL2, and B. burgdorferi and
IFN-gamma each stimulated the production of CXCL9 and CXCL10. However, with the
CD14+ cell fraction, B. burgdorferi alone stimulated the secretion of CCL4; B.
burgdorferi and IFN-gamma together induced CCL2 secretion, and IFN-gamma alone
stimulated the secretion of CXCL9 and CXCL10. The percentage of T cells
expressing CXCR3 or CCR5 was significantly greater in SFMC than PBMC, confirming
that TH1 effector cells were recruited to inflamed joints. However, when
stimulated with B. burgdorferi or IFN-gamma, SFMC and PBMC responded similarly.
CONCLUSIONS: B. burgdorferi stimulates PBMC or CD14+ monocytes/macrophages
directly to secrete CCL4, but spirochetal stimulation of other intermediate
cells, which are present in PBMC, is required to induce CD14+ cells to secrete
CCL2, CXCL9 and CXCL10. We conclude that B. burgdorferi stimulates
monocytes/macrophages directly and indirectly to guide innate and adaptive
immune responses in patients with Lyme arthritis.
http://eutils.ncbi.nlm.nih.gov/entrez/e ... md=prlinks
PMID: 20828409 [PubMed - as supplied by publisher]
1-vuotiaan Labradorinnoutajan, Samanthan, tarina.
"Eräänä aamuna Samantha ei kyennyt liikkumaan. Se vain tuijotti meitä pelästyneen näköisenä. Mieheni nosti sen seisomaan ja ulos tarpeille. Samantha ei kyennyt kävelemään. Sen nivelet olivat tulehtuneet ja sillä oli kuumetta. Samantha sairasti Borrelioosia.
Koska koirien oireet häviävät antibiooteilla aluksi nopeasti ja siitä syystä monet eläinlääkärit kirjoittavat vain 2-3 vk:n antibiootit. Tri Cappel suosittelee pidempiä hoitoja koska tauti uusiutuu helposti. Antibioottien lisäksi jotkut lääkärit käyttävät eläinten hoidossa erilaisia lääkkeettömiä hoitoja.
Eläinlääkärit ovat tutkineet Borrelioosin kroonistumista: "Hoidimme koiria neljällä eri antibiootilla. Aluksi koirien oireet hävisivät ja bakteerien määrä elimistössä väheni, MUTTA antibiootit eivät kyenneet tuhoamaan kaikkia bakteereita. Ne piiloutuivat ja ajan myötä oireet palasivat takaisin.Taudin uusiutumista tutkittiin antamalla eläimille immuunipuolustusta heikentävää kortisonia. Seurauksena oli bakteerin aktivoituminen uudelleen.
http://www.whole-dog-journal.com/issues ... table=true
July 2001 Issue
Licking Lyme
Alternative and complementary prevention and treatment tips.
By the time a tick is engorged enough to pull
out with a tick-pulling tool (as opposed to
tweezers, which can grasp a smaller tick), it
has probably been feeding long enough to
transmit the Lyme disease-causing spirochete.
When I opened her crate that morning, Samantha didn?t move. Instead of racing around with a toy in her mouth, our bouncy one-year-old Labrador Retriever stared at us with wide brown eyes, looking frightened. She didn?t object when my husband lifted her, but when he set her down, she stood as though frozen. He carried her outside and held her while she urinated. When he let go, she couldn?t walk.
A few hours later, our vet announced that every joint in her body was inflamed and she had a fever. No wonder our puppy couldn?t move. She hurt all over. Samantha had Lyme disease.
Lyme disease affects thousands of Americans and their dogs and horses each year. Named for Old Lyme, Connecticut, where it was discovered formally identified in the 1970s, Lyme is a regional disease, with 90 percent of its cases in New England and the Middle Atlantic states. The rest come from the upper Mississippi (Wisconsin and nearby states) and parts of California and Oregon. A few dogs and people with Lyme disease live elsewhere, but they are believed to have been infected during travel or, in some cases, by ticks from migrating birds.
National Lyme disease risk map with four
categories of risk: This map (courtesy of the
Centers for Disease Control) demonstrates an
approximate distribution of predicted human
Lyme disease risk in the United States ? and
corresponds with the approximate location
of Lyme-bearing ticks. Darker colors equal
higher risks.
Veterinarians in the Northeast know Lyme disease well. ?Its symptoms are very noticeable in dogs,? says Beverly Cappel, DVM, in Chestnut Ridge, NY. ?They look like they?re coming down with the flu. They ache everywhere, walk hunched over as though stepping on eggshells, limp, have no appetite, and move in slow motion.
Their necks are stiff, their heads ache, they don?t want to look up at the light, and they squint.?
Stealthy spirochetes
The microorganism that causes Lyme disease is Borrelia burgdorferi, a spirochete (pronounced SPY-ro-keet) or spiral-shaped bacterium. Leptospirosis and syphilis are also caused by spirochetes, which are extremely difficult to eradicate because they hide in tendons, muscle tissue, lymph nodes, organs such as the heart and brain, and other parts of the body, where they can remain dormant for years.
In humans, Lyme disease is often accompanied by a red rash that forms concentric circles (a signature bull?s eye rash), splotchy dots, or a wide band. Because its symptoms mimic other illnesses, it is difficult to diagnose. In advanced cases, it can cause vision problems, slowed or irregular heartbeat, facial paralysis, seizures, hearing loss, nerve damage, emotional instability, inflammation of arteries in the brain, and death.
According to Max Appel, DVM, PhD, Professor Emeritus at the Cornell University School of Veterinary Medicine and one of the nation?s leading authorities on canine Lyme disease, the illness is less ambiguous in dogs. Despite rumors to the contrary, he said in a March 2001 interview, Lyme disease does not cause bladder incontinence in spayed bitches, nor does it manifest in the variety of symptoms common in advanced human cases. ?Lyme disease can be fatal in dogs,? he explains, ?but its primary symptom is lameness. Dogs can get a rash, but it?s rarely seen. In advanced cases, renal (kidney) failure is the leading cause of death.?
Dr. Appel?s area of research is the pathogenesis of Lyme disease, the study of how the infection enters the body, moves through the bloodstream, incubates, and causes symptoms. His research group studied hundreds of dogs for more than a decade, defining the illness, conducting vaccination trials, and testing antibiotic treatments.
?We tried four different antibiotics against canine Lyme disease,? he says, ?and they seemed to have a good effect on clinical signs. The dogs recovered quite nicely, and there was a reduction in the number of spirochetes in the body. But antibiotics cannot eliminate the spirochetes entirely. They hide and, over time, can build up again and cause a relapse.? One way to trigger a relapse, says Dr. Appel, is by treating the dog with corticosteroids. ?These drugs are immune system suppressants,? he explained. ?We documented dogs that had been treated with antibiotics and were symptom-free for over a year and a half, but as soon as they were treated with corticosteroids, they went lame with Lyme disease. Steroid drugs are absolutely not a good idea for any dog that has been treated for Lyme disease.?
Injuries, illnesses, and other immune system stresses can also trigger recurrences. A wasp sting reactivated Samantha?s Lyme disease eight months after her first attack. Vaccinations, infections, an abscessed tooth, and even emotional stress can impair the immune system enough to let hidden spirochetes flourish.
Among medical doctors who treat human Lyme disease, there is much debate about its transmission by vectors other than ticks. The May 2001 edition of Alternative Medicine features a lengthy article on Lyme disease that claims it can be transmitted by fleas, mosquitoes, mites, and human-to-human contact. Dr. Appel disagrees.
?That?s speculation,? he says. ?The agent has been isolated from other vectors, but there is no proof whatsoever that these vectors can transmit the disease. A tick has to feed for 24 to 48 hours before it can transmit any spirochetes. During this time the Lyme disease spirochetes, which live in the mid-gut of the tick, migrate to the tick?s salivary gland. This method of transmission is so specific that even other species of tick, such as the dog tick, have not been shown to transmit Lyme disease even if they carry the spirochete. They can transmit other illnesses, such as Rocky Mountain spotted fever, ehrlichiosis, and babesiosis, but not Lyme disease.?
Dr. Appel housed dogs infected with Lyme disease with those that did not have the illness, and their prolonged exposure convinced him that Lyme disease is not transmitted from dog to dog by physical contact or exposure to urine or saliva. Although human babies have been born with the infection, in dogs the transmission from pregnant bitch to developing offspring or from infected mother to nursing puppies has not been documented.
Treating tick bites
A dog in the wrong place at the wrong time can be bit by dozens or even hundreds of ticks. Deer ticks go through three stages of life (larva, nymph, and adult), and feed only once in each of these stages; a blood meal ends each stage.
Larval ticks dine on mice and other small rodents, but nymphs and adults are a threat to dogs. Because they are small and their bites don?t itch, ticks are easily overlooked, especially adult deer ticks and the nymphs of any species. Ticks prefer warm, moist conditions, so double-check under collars and around ears. If you aren?t sure what a lump or bump is, inspect it with a magnifying glass. Warts, similar skin growths, and nipples can feel like feeding ticks.
Be careful when removing a tick to grasp it with tweezers firmly at the head, as close to the dog?s skin as possible, and slowly pull straight back. Never twist, press, burn, or apply irritating substances like kerosene to an attached tick because doing so can cause the parasite to expel the contents of its digestive tract, creating an unwanted hypodermic effect.
Three-percent hydrogen peroxide, the common disinfectant, is recommended for tick bites because the oxygen it contains destroys the Lyme disease bacteria. Hydrogen peroxide can be liberally poured over bites on light-haired dogs (keep away from eyes and apply directly to the skin) but because it?s a bleach, this method is not recommended for black or dark-haired dogs. Using an eyedropper to apply hydrogen peroxide directly to the bite helps prevent unwanted bleaching.
Aromatherapist Kristen Leigh Bell, whose Aromaleigh company specializes in products for dogs and cats, created a ?tick tincture? containing the essential oils of thyme (chemotype thujanol), hyssop (chemotype decumbens), and lavender. While studying with Dr. Kurt Schnaubelt at the Pacific Institute of Aromatherapy, Bell learned that these oils prevent Lyme disease when applied to tick bites, and she adapted the blend for canine use. ?The thyme and hyssop should be the specified chemotypes,? she explains, ?because unlike other thyme and hyssop oils, they contain no neurotoxic ketones or harsh and burning phenols. As a result, one can take advantage of their powerful antibacterial and antiviral qualities with very little risk.
?I suggest that dog owners use this blend immediately after removing ticks,? says Bell, ?or upon finding a tick bite or other suspicious bite on a dog?s body. It can be applied frequently for a day or two, then daily until the bite heals.? Dog owners can use Aromaleigh?s Canine Tick Tincture or blend their own by combining one tablespoon vegetable base oil (hazelnut, sweet almond, olive, sunflower, jojoba, etc.), six drops thyme (chemotype thujanol), six drops hyssop (chemotype decumbens), and six drops lavender or lavandin essential oil.
?These essential oils are expensive,? Bell warns, ?and they are not widely available, but it is important not to substitute less expensive essential oils for use on dogs. The use of essential oils in this manner is not a cure, it?s a preventive, but with daily grooming, careful tick removal, and the application of this blend, many dogs have avoided tick-borne illnesses.?
Bee propolis, sold in health food stores as a cold and flu preventive, is an excellent topical disinfectant and natural antibiotic. Liquid propolis can be applied to bites, cuts, burns, and other injuries with an eyedropper or mixed with small amounts of aloe vera gel to treat larger areas. Reapply frequently for best results, especially on the day of a tick bite and for the next two to three days.
Antibiotics: First line of treatment
Lyme-infected dogs improve so dramatically on antibiotics that many veterinarians regard their response as a Lyme disease test in itself. If an athletic, healthy dog experiences sudden-onset lameness from inflamed, tender joints, and recovers overnight on antibiotics, it?s probably Lyme disease. ?In most cases, you see results in 24 hours,? says Dr. Cappel.
Many veterinarians prescribe antibiotics for two to three weeks, but Dr. Cappel recommends longer treatment. ?I find that dogs tend to relapse if you don?t really wipe the bacteria out,? she says, ?so I use antibiotics for at least four weeks. I think this does a better job of finding and killing the spirochetes, so the dog is less likely to have a recurrence.?
According to Connecticut veterinarian Mary Wakeman, DVM, ?One side effect of antibiotic therapy is actually a sign that the treatment is working. It?s called the Jarish-Herxheimer reaction and it occurs when the body has an inflammatory response to all those dead spirochetes. Its more common name is the ?die-off? reaction. Depending on how overwhelmed its system is, a dog can experience one to several days of feeling worse than before.?
More importantly, says Dr. Wakeman, the die-off reaction can affect pregnant bitches, causing miscarriage. ?I recommend screening bitches living here in the Northeast with the Lyme Western Blot blood test four to six weeks before they are due in heat,? she says. ?to be sure they don?t have Lyme disease.?
Homeopathy
Although classical homeopathy does not consider Lyme disease a true illness ? like syphilis it is considered a ?chronic miasm? caused by an immaterial substance that produces disease by disrupting the vital force ? one veterinary homeopath in Connecticut takes a different view. After testing different remedies with limited success, Stephen Tobin, DVM, discovered that Ledum palustre in a 1M potency given three times daily for three days is ?about as close as you can get to a specific cure.? According to Dr. Tobin, this method has cured cats, dogs, and horses with recent and established infections, some of which were first treated with antibiotics. In addition, he uses the Lyme disease nosode, a homeopathic preparation of Borrelia burgdorferi 60x as a preventive, giving one dose (one dropperful) daily for one week, then one dose weekly for one month, and one dose every six months indefinitely.
Dr. Tobin says that since he began treating dogs for Lyme disease with homeopathy 10 years ago, he has worked with an estimated 1,000 patients, nearly all with complete success. ?There are other homeopathic remedies that treat the symptoms of Lyme disease,? he says, ?but I consider Ledum the genus epidemicus for this illness. The 1M strength is not widely sold, but lower strengths are. If your dog develops symptoms, you could try Ledum 30C, and if the symptoms come back, you could order the higher potency. If you spend a lot of time in the woods or have large fields behind your house, Ledum 1M is worth keeping on hand,? he says.
?The nosode is a good investment for dog owners here in the Northeast,? he continues, ?for it provides better protection than is generally seen with the vaccine. I don?t claim that the nosode offers 100 percent protection, but it does seem to work in most cases.?
While Dr. Tobin finds that Ledum by itself clears most canine Lyme disease, Dr. Cappel uses the nosode for both prevention and treatment. ?I?m convinced that the homeopathics are effective,? she says, ?but they take longer to work, and I don?t like to see animals suffer. I give the Lyme disease nosode at the same time as antibiotics, but I continue the nosode for several months. When I had Lyme disease, I used only the nosode for myself because it was my decision, but when my dog had Lyme, I put her on doxycycline and then the nosode.?
As part of her herbal therapy for Lyme disease, Vermont-based master herbalist Hart Brent recommends giving one dose of Ledum 1M as soon as possible after a tick bite, then giving 10 drops of the Lyme disease nosode once per day.
Alternative therapies adapted from human treatments
With an estimated 10,000 to 15,000 new cases of human Lyme disease diagnosed annually, it?s not surprising that holistic health practitioners are experimenting with therapies that support or replace conventional treatment, especially because conventional treatment has adverse side effects and is not always effective. Numerous herbal, nutritional, and even aroma-based therapies have helped people with Lyme disease. In fact, because the treatments worked so well, they have been given to Lyme-infected dogs with excellent results.
The following have not been tested in scientifically controlled studies, and they haven?t been tried by the veterinarians I interviewed. However, the information offered by the practitioners interviewed below is compelling. If you are interested in using one of the products described below, ask your holistic veterinarian for help.
? D-Lenolate olive leaf extract. Some herbal products are effective alternatives to antibiotics and kill pathogens so effectively that they, too, cause a die-off reaction. Les Nachman, Director of Herbal Technology at East Park Research, which manufactures d-Lenolate olive leaf extract, reports that thousands of human patients have successfully treated their Lyme disease with this product alone.
?D-Lenolate is helpful against any pathogenic involvement,? Nachman says, ?and it?s safe for dogs and other animals. Its only side effect is the die-off that occurs when it kills viruses, bacteria, yeasts, fungi, and parasites such as pinworms.?
The recommended human dose is two capsules three times a day, but Nachman recommends giving dogs, even large breeds, substantially less. ?For a 50-pound dog I?d start with one capsule twice a day,? he says. ?If that doesn?t cause significant improvement, you can increase the dose every day until it does. If a dog doesn?t swallow pills readily, hiding the capsules in food works better than mixing the contents with food due to the powder?s bitter taste.?
? ?Spirochete.? This herbal product, developed by the late Hannah Kroeger at Kroeger Herb Products, contains nettle, yerba santa, goldenrod, monolaurin (a nutritional product that is supposed to coat receptor sites on healthy cell walls so that infectious agents cannot bind with the cell), and organic tobacco. The manufacturer alleges the product to be effective in treating active cases of Lyme, including those that are slow to improve or have complications. The recommended human dosage is two or three capsules twice daily. For dogs, use one capsule per 20 to 25 pounds of body weight daily in divided doses.
? Teasel root tinture. Margi Flint is a practicing herbalist in Massachusetts whose clients include Lyme disease patients undergoing antibiotic therapy. ?Most of these patients respond very well to small doses of a tincture of teasel root (Dipsacus spp.),? she says. ?The other part of their treatment is hyperthermia, which means high heat, from frequent saunas or steam baths. The spirochetes hate heat, and both the tincture and the heat chase them out of hiding to where antibiotics can reach them.? While hyperthermia isn?t part of her protocol for dogs (?It?s just too hot,? she says), Flint recommends massaging three drops of teasel tincture into the ear three times per day.
?Place the drops deep in the ear canal or on the skin of the ear flap,? she explains. ?Use three drops in either ear three times a day for four to six weeks, then one drop in the ear three times a day for four to six weeks, then take a month off. Repeat the cycle if symptoms recur after that.? Tom Priester, a practicing herbalist in Bradford, New York, used teasel tincture instead of antibiotics to treat his Australian Blue Heelers when they contracted Lyme disease last year. ?I gave it to them by mouth between meals,? he says. ?The male responded within 24 hours, and the female took even less time. After one week, I reduced the dose from three drops three times a day to one drop three times a day and continued that for six weeks.?
? Propolis, Lomatium, and Waltheria Formulas. In Vermont, master herbalist Hart Brent developed a separate protocol for treating people in three different stages of Lyme disease; the protocols can be used by dogs as well as people.
?I use a Stage I (early Lyme disease) protocol as a preventive, as soon as a dog is bitten,? says Brent. ?There is such a time delay between the tick bite and the onset of symptoms in dogs that I consider all dogs that show clinical signs as being in Stage II (disseminated Lyme disease) or Stage III (advanced) when they are first diagnosed.?
In Stage I of Brent?s protocol, the patient takes Propolis Formula (tinctures of propolis resin, echinacea root, red root, and licorice root) for four days, followed by three days of Lomatium Formula (lomatium root, witch hazel, elderberry, and prickly ash). This schedule is repeated as needed, usually for at least a month. For a 60-pound dog, Brent recommends 20 to 40 drops of tincture per dose by mouth or applied to the ear flap?s inner skin, which absorbs them quickly. In all three protocols, her ?Spirokete? essential oil blend (peppermint, helichrysum, clove, and myrrh oils) is applied twice daily to the ear skin.
For Stage II/Disseminated Lyme disease, which affects the entire body and its organs, she recommends four days of Lomatium Formula alternate with three days of Waltheria Formula (waltheria root, osha root, American ginseng root, and Artemisia annua). For Stage III/Chronic Lyme disease, which is the most advanced stage of the infection, Brent uses four days of Waltheria Formula alternated with three days of Lomatium Formula.
? Essential oils. Aromatherapist Suzanne Catty, of Toronto, Canada, recommends treating canine Lyme disease with antibiotic essential oils such as oregano, winter savory, cinnamon bark, thyme (chemotype thymol), and thyme (chemotype thujanol). ?Alone or with prescription antibiotics,? she says, ?these essential oils kill many kinds of bacteria, including spirochetes. Combine these oils, as available, and give one drop of the blend every three hours for three days, up to a maximum of six drops per day for a 50- to 75-pound dog. Only organically grown or wildcrafted, therapeutic-quality essential oils should be used in this manner. I recommend putting the drops in capsules containing herbs that support detoxification or combining them with a tincture of milk thistle seed and goldenseal root, which also support the liver.?
? Hydrosols. Catty is one of the world?s leading authorities on hydrosols, which are also called flower waters, herb waters, or hydrolats. These byproducts of the steam distillation process contain trace amounts of essential oils, are far more concentrated than herbal teas but gentle and nontoxic, have significant therapeutic benefits, and are ideal for use with pets. She notes that some hydrosols, such as Greenland moss, cleanse and support the liver while repairing damage done by bacteria, making them ideal for dogs recovering from Lyme disease. Hydrosols can be added to food or drinking water, using one tablespoon hydrosol per 25 to 30 pounds of body weight per day.
? Green Terrestrial?s Auntie Lyme tea. This commercially prepared tea contains nettle, red clover, comfrey, calendula, peach leaf, strawberry leaf, mint, burdock seed, and milk thistle seed. These liver-tonic ingredients are recommended as an adjunct in treating active cases and as a support for those previously treated for Lyme disease. Brew a medicinal-strength infusion by steeping one tablespoon dry herbs in one cup boiling water; keep in a covered pan until cool. Add it to your dog?s food or drinking water, using one tablespoon strained tea per 10 pounds of body weight per day. Refrigerate leftover tea for up to a week.
? Immune-stimulating herbs. Many other herbs help repair the body, improve energy, and help fight infection. The Chinese herb astragalus is a powerful immune system strengthener. Ashwaganda, long used in India?s Ayurvedic medicine, has anti-inflammatory properties and aids recuperation. Dr. Cappel often adds several drops of an echinacea-goldenseal tincture, or a tincture that combines echinacea, goldenseal, and chaparral, to her protocol. ?These are all good immune system stimulants,? she explains, ?and although none of them are specifically for Lyme disease, I think they make a difference.?
Doing what helps
Finally, I can attest that hands-on therapies that support a dog?s immune system help prevent recurrences. In addition to her early treatment with antibiotics, nutritional supplements, and herbal support therapies, I credit Samantha?s monthly acupuncture treatments and chiropractic adjustments for her athletic, Lyme-free middle age.
"Eräänä aamuna Samantha ei kyennyt liikkumaan. Se vain tuijotti meitä pelästyneen näköisenä. Mieheni nosti sen seisomaan ja ulos tarpeille. Samantha ei kyennyt kävelemään. Sen nivelet olivat tulehtuneet ja sillä oli kuumetta. Samantha sairasti Borrelioosia.
Koska koirien oireet häviävät antibiooteilla aluksi nopeasti ja siitä syystä monet eläinlääkärit kirjoittavat vain 2-3 vk:n antibiootit. Tri Cappel suosittelee pidempiä hoitoja koska tauti uusiutuu helposti. Antibioottien lisäksi jotkut lääkärit käyttävät eläinten hoidossa erilaisia lääkkeettömiä hoitoja.
Eläinlääkärit ovat tutkineet Borrelioosin kroonistumista: "Hoidimme koiria neljällä eri antibiootilla. Aluksi koirien oireet hävisivät ja bakteerien määrä elimistössä väheni, MUTTA antibiootit eivät kyenneet tuhoamaan kaikkia bakteereita. Ne piiloutuivat ja ajan myötä oireet palasivat takaisin.Taudin uusiutumista tutkittiin antamalla eläimille immuunipuolustusta heikentävää kortisonia. Seurauksena oli bakteerin aktivoituminen uudelleen.
http://www.whole-dog-journal.com/issues ... table=true
July 2001 Issue
Licking Lyme
Alternative and complementary prevention and treatment tips.
By the time a tick is engorged enough to pull
out with a tick-pulling tool (as opposed to
tweezers, which can grasp a smaller tick), it
has probably been feeding long enough to
transmit the Lyme disease-causing spirochete.
When I opened her crate that morning, Samantha didn?t move. Instead of racing around with a toy in her mouth, our bouncy one-year-old Labrador Retriever stared at us with wide brown eyes, looking frightened. She didn?t object when my husband lifted her, but when he set her down, she stood as though frozen. He carried her outside and held her while she urinated. When he let go, she couldn?t walk.
A few hours later, our vet announced that every joint in her body was inflamed and she had a fever. No wonder our puppy couldn?t move. She hurt all over. Samantha had Lyme disease.
Lyme disease affects thousands of Americans and their dogs and horses each year. Named for Old Lyme, Connecticut, where it was discovered formally identified in the 1970s, Lyme is a regional disease, with 90 percent of its cases in New England and the Middle Atlantic states. The rest come from the upper Mississippi (Wisconsin and nearby states) and parts of California and Oregon. A few dogs and people with Lyme disease live elsewhere, but they are believed to have been infected during travel or, in some cases, by ticks from migrating birds.
National Lyme disease risk map with four
categories of risk: This map (courtesy of the
Centers for Disease Control) demonstrates an
approximate distribution of predicted human
Lyme disease risk in the United States ? and
corresponds with the approximate location
of Lyme-bearing ticks. Darker colors equal
higher risks.
Veterinarians in the Northeast know Lyme disease well. ?Its symptoms are very noticeable in dogs,? says Beverly Cappel, DVM, in Chestnut Ridge, NY. ?They look like they?re coming down with the flu. They ache everywhere, walk hunched over as though stepping on eggshells, limp, have no appetite, and move in slow motion.
Their necks are stiff, their heads ache, they don?t want to look up at the light, and they squint.?
Stealthy spirochetes
The microorganism that causes Lyme disease is Borrelia burgdorferi, a spirochete (pronounced SPY-ro-keet) or spiral-shaped bacterium. Leptospirosis and syphilis are also caused by spirochetes, which are extremely difficult to eradicate because they hide in tendons, muscle tissue, lymph nodes, organs such as the heart and brain, and other parts of the body, where they can remain dormant for years.
In humans, Lyme disease is often accompanied by a red rash that forms concentric circles (a signature bull?s eye rash), splotchy dots, or a wide band. Because its symptoms mimic other illnesses, it is difficult to diagnose. In advanced cases, it can cause vision problems, slowed or irregular heartbeat, facial paralysis, seizures, hearing loss, nerve damage, emotional instability, inflammation of arteries in the brain, and death.
According to Max Appel, DVM, PhD, Professor Emeritus at the Cornell University School of Veterinary Medicine and one of the nation?s leading authorities on canine Lyme disease, the illness is less ambiguous in dogs. Despite rumors to the contrary, he said in a March 2001 interview, Lyme disease does not cause bladder incontinence in spayed bitches, nor does it manifest in the variety of symptoms common in advanced human cases. ?Lyme disease can be fatal in dogs,? he explains, ?but its primary symptom is lameness. Dogs can get a rash, but it?s rarely seen. In advanced cases, renal (kidney) failure is the leading cause of death.?
Dr. Appel?s area of research is the pathogenesis of Lyme disease, the study of how the infection enters the body, moves through the bloodstream, incubates, and causes symptoms. His research group studied hundreds of dogs for more than a decade, defining the illness, conducting vaccination trials, and testing antibiotic treatments.
?We tried four different antibiotics against canine Lyme disease,? he says, ?and they seemed to have a good effect on clinical signs. The dogs recovered quite nicely, and there was a reduction in the number of spirochetes in the body. But antibiotics cannot eliminate the spirochetes entirely. They hide and, over time, can build up again and cause a relapse.? One way to trigger a relapse, says Dr. Appel, is by treating the dog with corticosteroids. ?These drugs are immune system suppressants,? he explained. ?We documented dogs that had been treated with antibiotics and were symptom-free for over a year and a half, but as soon as they were treated with corticosteroids, they went lame with Lyme disease. Steroid drugs are absolutely not a good idea for any dog that has been treated for Lyme disease.?
Injuries, illnesses, and other immune system stresses can also trigger recurrences. A wasp sting reactivated Samantha?s Lyme disease eight months after her first attack. Vaccinations, infections, an abscessed tooth, and even emotional stress can impair the immune system enough to let hidden spirochetes flourish.
Among medical doctors who treat human Lyme disease, there is much debate about its transmission by vectors other than ticks. The May 2001 edition of Alternative Medicine features a lengthy article on Lyme disease that claims it can be transmitted by fleas, mosquitoes, mites, and human-to-human contact. Dr. Appel disagrees.
?That?s speculation,? he says. ?The agent has been isolated from other vectors, but there is no proof whatsoever that these vectors can transmit the disease. A tick has to feed for 24 to 48 hours before it can transmit any spirochetes. During this time the Lyme disease spirochetes, which live in the mid-gut of the tick, migrate to the tick?s salivary gland. This method of transmission is so specific that even other species of tick, such as the dog tick, have not been shown to transmit Lyme disease even if they carry the spirochete. They can transmit other illnesses, such as Rocky Mountain spotted fever, ehrlichiosis, and babesiosis, but not Lyme disease.?
Dr. Appel housed dogs infected with Lyme disease with those that did not have the illness, and their prolonged exposure convinced him that Lyme disease is not transmitted from dog to dog by physical contact or exposure to urine or saliva. Although human babies have been born with the infection, in dogs the transmission from pregnant bitch to developing offspring or from infected mother to nursing puppies has not been documented.
Treating tick bites
A dog in the wrong place at the wrong time can be bit by dozens or even hundreds of ticks. Deer ticks go through three stages of life (larva, nymph, and adult), and feed only once in each of these stages; a blood meal ends each stage.
Larval ticks dine on mice and other small rodents, but nymphs and adults are a threat to dogs. Because they are small and their bites don?t itch, ticks are easily overlooked, especially adult deer ticks and the nymphs of any species. Ticks prefer warm, moist conditions, so double-check under collars and around ears. If you aren?t sure what a lump or bump is, inspect it with a magnifying glass. Warts, similar skin growths, and nipples can feel like feeding ticks.
Be careful when removing a tick to grasp it with tweezers firmly at the head, as close to the dog?s skin as possible, and slowly pull straight back. Never twist, press, burn, or apply irritating substances like kerosene to an attached tick because doing so can cause the parasite to expel the contents of its digestive tract, creating an unwanted hypodermic effect.
Three-percent hydrogen peroxide, the common disinfectant, is recommended for tick bites because the oxygen it contains destroys the Lyme disease bacteria. Hydrogen peroxide can be liberally poured over bites on light-haired dogs (keep away from eyes and apply directly to the skin) but because it?s a bleach, this method is not recommended for black or dark-haired dogs. Using an eyedropper to apply hydrogen peroxide directly to the bite helps prevent unwanted bleaching.
Aromatherapist Kristen Leigh Bell, whose Aromaleigh company specializes in products for dogs and cats, created a ?tick tincture? containing the essential oils of thyme (chemotype thujanol), hyssop (chemotype decumbens), and lavender. While studying with Dr. Kurt Schnaubelt at the Pacific Institute of Aromatherapy, Bell learned that these oils prevent Lyme disease when applied to tick bites, and she adapted the blend for canine use. ?The thyme and hyssop should be the specified chemotypes,? she explains, ?because unlike other thyme and hyssop oils, they contain no neurotoxic ketones or harsh and burning phenols. As a result, one can take advantage of their powerful antibacterial and antiviral qualities with very little risk.
?I suggest that dog owners use this blend immediately after removing ticks,? says Bell, ?or upon finding a tick bite or other suspicious bite on a dog?s body. It can be applied frequently for a day or two, then daily until the bite heals.? Dog owners can use Aromaleigh?s Canine Tick Tincture or blend their own by combining one tablespoon vegetable base oil (hazelnut, sweet almond, olive, sunflower, jojoba, etc.), six drops thyme (chemotype thujanol), six drops hyssop (chemotype decumbens), and six drops lavender or lavandin essential oil.
?These essential oils are expensive,? Bell warns, ?and they are not widely available, but it is important not to substitute less expensive essential oils for use on dogs. The use of essential oils in this manner is not a cure, it?s a preventive, but with daily grooming, careful tick removal, and the application of this blend, many dogs have avoided tick-borne illnesses.?
Bee propolis, sold in health food stores as a cold and flu preventive, is an excellent topical disinfectant and natural antibiotic. Liquid propolis can be applied to bites, cuts, burns, and other injuries with an eyedropper or mixed with small amounts of aloe vera gel to treat larger areas. Reapply frequently for best results, especially on the day of a tick bite and for the next two to three days.
Antibiotics: First line of treatment
Lyme-infected dogs improve so dramatically on antibiotics that many veterinarians regard their response as a Lyme disease test in itself. If an athletic, healthy dog experiences sudden-onset lameness from inflamed, tender joints, and recovers overnight on antibiotics, it?s probably Lyme disease. ?In most cases, you see results in 24 hours,? says Dr. Cappel.
Many veterinarians prescribe antibiotics for two to three weeks, but Dr. Cappel recommends longer treatment. ?I find that dogs tend to relapse if you don?t really wipe the bacteria out,? she says, ?so I use antibiotics for at least four weeks. I think this does a better job of finding and killing the spirochetes, so the dog is less likely to have a recurrence.?
According to Connecticut veterinarian Mary Wakeman, DVM, ?One side effect of antibiotic therapy is actually a sign that the treatment is working. It?s called the Jarish-Herxheimer reaction and it occurs when the body has an inflammatory response to all those dead spirochetes. Its more common name is the ?die-off? reaction. Depending on how overwhelmed its system is, a dog can experience one to several days of feeling worse than before.?
More importantly, says Dr. Wakeman, the die-off reaction can affect pregnant bitches, causing miscarriage. ?I recommend screening bitches living here in the Northeast with the Lyme Western Blot blood test four to six weeks before they are due in heat,? she says. ?to be sure they don?t have Lyme disease.?
Homeopathy
Although classical homeopathy does not consider Lyme disease a true illness ? like syphilis it is considered a ?chronic miasm? caused by an immaterial substance that produces disease by disrupting the vital force ? one veterinary homeopath in Connecticut takes a different view. After testing different remedies with limited success, Stephen Tobin, DVM, discovered that Ledum palustre in a 1M potency given three times daily for three days is ?about as close as you can get to a specific cure.? According to Dr. Tobin, this method has cured cats, dogs, and horses with recent and established infections, some of which were first treated with antibiotics. In addition, he uses the Lyme disease nosode, a homeopathic preparation of Borrelia burgdorferi 60x as a preventive, giving one dose (one dropperful) daily for one week, then one dose weekly for one month, and one dose every six months indefinitely.
Dr. Tobin says that since he began treating dogs for Lyme disease with homeopathy 10 years ago, he has worked with an estimated 1,000 patients, nearly all with complete success. ?There are other homeopathic remedies that treat the symptoms of Lyme disease,? he says, ?but I consider Ledum the genus epidemicus for this illness. The 1M strength is not widely sold, but lower strengths are. If your dog develops symptoms, you could try Ledum 30C, and if the symptoms come back, you could order the higher potency. If you spend a lot of time in the woods or have large fields behind your house, Ledum 1M is worth keeping on hand,? he says.
?The nosode is a good investment for dog owners here in the Northeast,? he continues, ?for it provides better protection than is generally seen with the vaccine. I don?t claim that the nosode offers 100 percent protection, but it does seem to work in most cases.?
While Dr. Tobin finds that Ledum by itself clears most canine Lyme disease, Dr. Cappel uses the nosode for both prevention and treatment. ?I?m convinced that the homeopathics are effective,? she says, ?but they take longer to work, and I don?t like to see animals suffer. I give the Lyme disease nosode at the same time as antibiotics, but I continue the nosode for several months. When I had Lyme disease, I used only the nosode for myself because it was my decision, but when my dog had Lyme, I put her on doxycycline and then the nosode.?
As part of her herbal therapy for Lyme disease, Vermont-based master herbalist Hart Brent recommends giving one dose of Ledum 1M as soon as possible after a tick bite, then giving 10 drops of the Lyme disease nosode once per day.
Alternative therapies adapted from human treatments
With an estimated 10,000 to 15,000 new cases of human Lyme disease diagnosed annually, it?s not surprising that holistic health practitioners are experimenting with therapies that support or replace conventional treatment, especially because conventional treatment has adverse side effects and is not always effective. Numerous herbal, nutritional, and even aroma-based therapies have helped people with Lyme disease. In fact, because the treatments worked so well, they have been given to Lyme-infected dogs with excellent results.
The following have not been tested in scientifically controlled studies, and they haven?t been tried by the veterinarians I interviewed. However, the information offered by the practitioners interviewed below is compelling. If you are interested in using one of the products described below, ask your holistic veterinarian for help.
? D-Lenolate olive leaf extract. Some herbal products are effective alternatives to antibiotics and kill pathogens so effectively that they, too, cause a die-off reaction. Les Nachman, Director of Herbal Technology at East Park Research, which manufactures d-Lenolate olive leaf extract, reports that thousands of human patients have successfully treated their Lyme disease with this product alone.
?D-Lenolate is helpful against any pathogenic involvement,? Nachman says, ?and it?s safe for dogs and other animals. Its only side effect is the die-off that occurs when it kills viruses, bacteria, yeasts, fungi, and parasites such as pinworms.?
The recommended human dose is two capsules three times a day, but Nachman recommends giving dogs, even large breeds, substantially less. ?For a 50-pound dog I?d start with one capsule twice a day,? he says. ?If that doesn?t cause significant improvement, you can increase the dose every day until it does. If a dog doesn?t swallow pills readily, hiding the capsules in food works better than mixing the contents with food due to the powder?s bitter taste.?
? ?Spirochete.? This herbal product, developed by the late Hannah Kroeger at Kroeger Herb Products, contains nettle, yerba santa, goldenrod, monolaurin (a nutritional product that is supposed to coat receptor sites on healthy cell walls so that infectious agents cannot bind with the cell), and organic tobacco. The manufacturer alleges the product to be effective in treating active cases of Lyme, including those that are slow to improve or have complications. The recommended human dosage is two or three capsules twice daily. For dogs, use one capsule per 20 to 25 pounds of body weight daily in divided doses.
? Teasel root tinture. Margi Flint is a practicing herbalist in Massachusetts whose clients include Lyme disease patients undergoing antibiotic therapy. ?Most of these patients respond very well to small doses of a tincture of teasel root (Dipsacus spp.),? she says. ?The other part of their treatment is hyperthermia, which means high heat, from frequent saunas or steam baths. The spirochetes hate heat, and both the tincture and the heat chase them out of hiding to where antibiotics can reach them.? While hyperthermia isn?t part of her protocol for dogs (?It?s just too hot,? she says), Flint recommends massaging three drops of teasel tincture into the ear three times per day.
?Place the drops deep in the ear canal or on the skin of the ear flap,? she explains. ?Use three drops in either ear three times a day for four to six weeks, then one drop in the ear three times a day for four to six weeks, then take a month off. Repeat the cycle if symptoms recur after that.? Tom Priester, a practicing herbalist in Bradford, New York, used teasel tincture instead of antibiotics to treat his Australian Blue Heelers when they contracted Lyme disease last year. ?I gave it to them by mouth between meals,? he says. ?The male responded within 24 hours, and the female took even less time. After one week, I reduced the dose from three drops three times a day to one drop three times a day and continued that for six weeks.?
? Propolis, Lomatium, and Waltheria Formulas. In Vermont, master herbalist Hart Brent developed a separate protocol for treating people in three different stages of Lyme disease; the protocols can be used by dogs as well as people.
?I use a Stage I (early Lyme disease) protocol as a preventive, as soon as a dog is bitten,? says Brent. ?There is such a time delay between the tick bite and the onset of symptoms in dogs that I consider all dogs that show clinical signs as being in Stage II (disseminated Lyme disease) or Stage III (advanced) when they are first diagnosed.?
In Stage I of Brent?s protocol, the patient takes Propolis Formula (tinctures of propolis resin, echinacea root, red root, and licorice root) for four days, followed by three days of Lomatium Formula (lomatium root, witch hazel, elderberry, and prickly ash). This schedule is repeated as needed, usually for at least a month. For a 60-pound dog, Brent recommends 20 to 40 drops of tincture per dose by mouth or applied to the ear flap?s inner skin, which absorbs them quickly. In all three protocols, her ?Spirokete? essential oil blend (peppermint, helichrysum, clove, and myrrh oils) is applied twice daily to the ear skin.
For Stage II/Disseminated Lyme disease, which affects the entire body and its organs, she recommends four days of Lomatium Formula alternate with three days of Waltheria Formula (waltheria root, osha root, American ginseng root, and Artemisia annua). For Stage III/Chronic Lyme disease, which is the most advanced stage of the infection, Brent uses four days of Waltheria Formula alternated with three days of Lomatium Formula.
? Essential oils. Aromatherapist Suzanne Catty, of Toronto, Canada, recommends treating canine Lyme disease with antibiotic essential oils such as oregano, winter savory, cinnamon bark, thyme (chemotype thymol), and thyme (chemotype thujanol). ?Alone or with prescription antibiotics,? she says, ?these essential oils kill many kinds of bacteria, including spirochetes. Combine these oils, as available, and give one drop of the blend every three hours for three days, up to a maximum of six drops per day for a 50- to 75-pound dog. Only organically grown or wildcrafted, therapeutic-quality essential oils should be used in this manner. I recommend putting the drops in capsules containing herbs that support detoxification or combining them with a tincture of milk thistle seed and goldenseal root, which also support the liver.?
? Hydrosols. Catty is one of the world?s leading authorities on hydrosols, which are also called flower waters, herb waters, or hydrolats. These byproducts of the steam distillation process contain trace amounts of essential oils, are far more concentrated than herbal teas but gentle and nontoxic, have significant therapeutic benefits, and are ideal for use with pets. She notes that some hydrosols, such as Greenland moss, cleanse and support the liver while repairing damage done by bacteria, making them ideal for dogs recovering from Lyme disease. Hydrosols can be added to food or drinking water, using one tablespoon hydrosol per 25 to 30 pounds of body weight per day.
? Green Terrestrial?s Auntie Lyme tea. This commercially prepared tea contains nettle, red clover, comfrey, calendula, peach leaf, strawberry leaf, mint, burdock seed, and milk thistle seed. These liver-tonic ingredients are recommended as an adjunct in treating active cases and as a support for those previously treated for Lyme disease. Brew a medicinal-strength infusion by steeping one tablespoon dry herbs in one cup boiling water; keep in a covered pan until cool. Add it to your dog?s food or drinking water, using one tablespoon strained tea per 10 pounds of body weight per day. Refrigerate leftover tea for up to a week.
? Immune-stimulating herbs. Many other herbs help repair the body, improve energy, and help fight infection. The Chinese herb astragalus is a powerful immune system strengthener. Ashwaganda, long used in India?s Ayurvedic medicine, has anti-inflammatory properties and aids recuperation. Dr. Cappel often adds several drops of an echinacea-goldenseal tincture, or a tincture that combines echinacea, goldenseal, and chaparral, to her protocol. ?These are all good immune system stimulants,? she explains, ?and although none of them are specifically for Lyme disease, I think they make a difference.?
Doing what helps
Finally, I can attest that hands-on therapies that support a dog?s immune system help prevent recurrences. In addition to her early treatment with antibiotics, nutritional supplements, and herbal support therapies, I credit Samantha?s monthly acupuncture treatments and chiropractic adjustments for her athletic, Lyme-free middle age.
Borrelia-bakteerikantojen geneettinen kartta on selviämässä. Löydön toivotaan auttavan nopeamman diagnoosin tekemisessä sekä rokotteiden kehittelyssä.
Tri Luft tutkijaryhmineen on tutkinut asiaa vuosien ajan. He ovat ihmetelleet miksi joillakin taudin oireet kestävät vain joitakin viikkoja ja joillakin tauti etenee eri puolille elimistöä. (2010)
http://www.thestar.com/iphone/news/worl ... me-disease
Scientist makes inroads on Lyme disease
October 12, 2010 00:10:00
Delthia Ricks and Sophia Chang Newsday
MELVILLE, N.Y.?A Stony Brook scientist has helped map the genetic family tree of the bacterial strains that cause Lyme disease, a finding that raises hopes for faster diagnosis and new vaccines, scientists said Tuesday.
Dr. Benjamin Luft and colleagues have been on the trail of Lyme disease for years, aiming to discover why some people are affected by symptoms that last a few weeks, while others develop invasive infections that attack major organ systems. The mapping of more than a dozen bacterial strains moves science a step closer to finding out.
The availability of such precise genetic information is expected to help develop diagnostic tests sensitive to the exact strain that has caused a patient?s infection, said Luft, a professor of medicine at Stony Brook University?s medical school. He presented his research Monday in Washington, D.C., at the Institute of Medicine, an arm of the National Academy of Sciences.
Of the varying strains, Luft said some cause only a skin rash, while others, which he characterized as more serious, ?go into the blood stream and spread throughout.?
According to the U.S. Centers for Disease Control and Prevention, cases of severe forms of Lyme disease ? the most frequently transmitted tick-borne infection in North America ?have been rising for two decades.
Luft said he believes the new genetic information eventually could play a role in the development of vaccines. One vaccine ? the first against Lyme disease, and developed before the findings were announced this week ? is slated for human trials in January.
Working with a team of researchers from across the United States, Luft and colleagues parsed the entire genetic codes of 13 types of the Borrelia burgdorferi bacteria that cause Lyme disease.
A renowned Lyme disease investigator, who was not connected with the study, said the work ?is of enormous value? ? an important advance with practical applications.
The researcher, Dr. Brian Fallon, director of Columbia University?s Lyme and Tick-borne Disease Research Center in Manhattan, said Tuesday that the current method of screening for Lyme is notorious for ?being far too insensitive for early Lyme disease and for neurologic Lyme disease.?
?Mapping of these 13 strains will help us to learn more about the invasiveness and virulence of these particular strains, as well as whether they have unique clinical profiles,? Fallon said.
Tri Luft tutkijaryhmineen on tutkinut asiaa vuosien ajan. He ovat ihmetelleet miksi joillakin taudin oireet kestävät vain joitakin viikkoja ja joillakin tauti etenee eri puolille elimistöä. (2010)
http://www.thestar.com/iphone/news/worl ... me-disease
Scientist makes inroads on Lyme disease
October 12, 2010 00:10:00
Delthia Ricks and Sophia Chang Newsday
MELVILLE, N.Y.?A Stony Brook scientist has helped map the genetic family tree of the bacterial strains that cause Lyme disease, a finding that raises hopes for faster diagnosis and new vaccines, scientists said Tuesday.
Dr. Benjamin Luft and colleagues have been on the trail of Lyme disease for years, aiming to discover why some people are affected by symptoms that last a few weeks, while others develop invasive infections that attack major organ systems. The mapping of more than a dozen bacterial strains moves science a step closer to finding out.
The availability of such precise genetic information is expected to help develop diagnostic tests sensitive to the exact strain that has caused a patient?s infection, said Luft, a professor of medicine at Stony Brook University?s medical school. He presented his research Monday in Washington, D.C., at the Institute of Medicine, an arm of the National Academy of Sciences.
Of the varying strains, Luft said some cause only a skin rash, while others, which he characterized as more serious, ?go into the blood stream and spread throughout.?
According to the U.S. Centers for Disease Control and Prevention, cases of severe forms of Lyme disease ? the most frequently transmitted tick-borne infection in North America ?have been rising for two decades.
Luft said he believes the new genetic information eventually could play a role in the development of vaccines. One vaccine ? the first against Lyme disease, and developed before the findings were announced this week ? is slated for human trials in January.
Working with a team of researchers from across the United States, Luft and colleagues parsed the entire genetic codes of 13 types of the Borrelia burgdorferi bacteria that cause Lyme disease.
A renowned Lyme disease investigator, who was not connected with the study, said the work ?is of enormous value? ? an important advance with practical applications.
The researcher, Dr. Brian Fallon, director of Columbia University?s Lyme and Tick-borne Disease Research Center in Manhattan, said Tuesday that the current method of screening for Lyme is notorious for ?being far too insensitive for early Lyme disease and for neurologic Lyme disease.?
?Mapping of these 13 strains will help us to learn more about the invasiveness and virulence of these particular strains, as well as whether they have unique clinical profiles,? Fallon said.